PREDICTORS OF HIV AND PULMONARY, TB INFECTIONS AMONG. ..
INJECTION DRUG USERS IN MOMBASA COUNTY, KENYA
VALENTINE BUDAMBULA
P97/13136/09
A THESIS SUBMITTED IN FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN PUBLIC HEALTH
IN THE SCHOOL OFPUBLICHEALTH,KENYATTA UNIVERSITY
DECEMBER, 2015
ENYA U IVE
ii
DECLARATION
This thesis is my original work and has not been presented for a degree in any other
University.
SigruJ.ture~ .• ~· .
VALENTINE BUDAMBULA
Department of Community Health
This thesis has been submitted for examination with our approval as University
supervisors.
Signature ..tk.:." . Date.91• (!~lf:p( r; .
PROF. MICHAEL OTIENO
KENYA TTA UNIVERSITY
Department of Medical Laboratory Sciences
-
Signature .
DR. TOM WERE
MASINDE MULIRO ·UNIVERSITY OF SCIENCE AND TECHNOLOGY-
Department of Medical Laboratory Sciences
III
DEDICATION
This is a special dedication to my family members who have shaped my life.
To my husband Joseph Luttson, thank you for your incalculable support, I salute thee.
To my father, the late Aaron Leonid Budambula (BA, Makerere University), who
believed in girl child education, Rest in Peace.
To my mother Zerephata, the first lady of the Budambula dynasty and a great matriarch,
I salute thee. And to my sister Prof. Nancy Budambula-Mong'are who is indeed a
distinguished woman without limits, I salute thee.
My special tribute to Mrs. Elizabeth Kipsang, my high school teacher (Kapsabet Girls
High School), for her immense love and psychosocial support, I salute thee. My
accolades to Mrs. Florence Lwoyelo (Director, Nurseconsult Services) for encouraging
and empowering me to pursue post graduate education, I salute thee.
IV
ACKNOWLEDGEMENT
I take this opportunity to thank God, my Ebenezer for thus this far He has brought me. I
convey my sincere gratitude to my supervisors Prof. Michael Otieno and Dr. Tom Were
whose support, patience and guidance have made this thesis to be successful. Further, I
am grateful to the staff and management of Bomu Hospital especially Mr. Musa
Mwamzuka, Ms. Ann Mwashumbe (both laboratory technicians), Ms Caroline Kai (TB
clinic) and Dr. Aabid A. Ahmed (the Chief Executive Officer). I am deeply indebted to
all the PWID in Mombasa who took their time to participate in the study, and to Mr.
Nasser Ahmed, a rehabilitated former IDU and currently a community health worker
who served as a link between the IDUs and 1. My sincere appreciation to research
assistants Ms. Linet Makena and Ms. Nancy Odhiambo as well as to the NASCOP team
hosted at Bomu especially Ms. Caroline Omeddo.
My sincere gratitude goes to the Technical University of Mombasa (TUM) for both
monetary (staff development and partial research funding) and non monetary support. I
acknowledge the gui~ance I received from the then TOM director of research, Dr.
Charles Matoka. This study was made possible through the funding received from the
National Commission for Science, Technology and Innovation (NACOSTI) grant
number NCST151003/065. To NACOSTI, thank you for making my dream come true.
Since it is not possible to thank each and every individual, I am forever indebted to
many who have contributed positively to this work both directly or indirectly through
prayers, moral support and encouragement. To all the above I saY,Ahsante sana.
vTABLE OF CONTENTS
Declaration .ii
Dedication Statement iii
Acknowledgement .iv
Table of Contents v
List of Figures x
List of Plates xi
List of Appendices xii
Abbreviation! Acronyms , .. . . . . . .. . .. . . . . . . . .. . . . . . . . . . .. . . . . . . . .. . .. . . . . . . . . xiii
Definition of Terms xvii
Abstract.. xviii
CHAPTER ONE: INTRODUCTION 1
1.1 Background to the Study 1
1.2 Statement of the Problem .4
1.3 Research Questions 6
1.4 Null Hypotheses 6
1.5 General Objective 7
1.6 Specific Objectives 7
1.7 Justification , 7
1.8 Limitations 8
1.9 Conceptual Framework. 8
CHAPTER TWO: LITERATURE REVIEW IO
2.1 Over View on Drugs Abused by Participants 10
2.lJ Narcotics '" .11
2.1.1.2 Morphine and Codeine 12
2.1.1.3 Heroin 13
2.1.1.3.1 Effects of Heroin .16
2.1.2 Stimulants 17
2.1.2.1 Cocaine -." 17
2.1.2.1.1 Forms of Cocaine 18
2.1.2.1.2 Effects of cocaine .20
Vl
2. J .2.2 Khat 21
2.1.2.2.2 Effects of Khat.. 24
2.1.2.3 Nicotine 25
2.1.2.3.1 Effects of nicotine .28
2.13 Cannabinoids 29
2.1.3.1 Effects of Marijuana 33
2.1.4 Benzodiazepines .34
2.1.4.1 Effects Rohypnol ' .36
2.1.5 Alcohol. 37
2.1.5.1 Effects of Alcohol.. , 39
2.2 Socio-demographic Characteristics .40
2.3 Drug Use Patterns .48
2.4 Nutrition 53
2.5 Tuberculosis 58
2.6mv 61
2.6.1mv and Injection Drug Use 62
2.6.2 Hl V Subtypes: Global Outlook. 64
2.6.3mv Subtypes in Kenya .- 66
2.6.4 HlV Subtypes in the IDU population 67
2.7 Drugs and Immunity 68
2.8 Other Common Co-morbidities 69
2.8.1 Hepatitis B and C , 69
2.8.1.1 Hepatitis B 69
2.8.1.2 Hepatitis C 69
2.8.2 Tetanus 70
2.8.3 Dermatological disorders 70
2.9 Prevention and Management of Drug Use and Addiction 71
2.9.1 Demand Reduction 72
2.9..2Supply Reduction 72
2.9.3 Harm Reduction 73
2.9.4 Rehabilitation , 78
VII
2.10 Challenges 78
2.11 Conclusion 79
CHAPTER THREE: MATERIALS AND METHODS 81
3.1 Study Design 81
3.2 Variables 81
3.3 Target and Study Population 81
3.4 Study Site 81
3.5 Sample Size 84
3.6 Sampling Procedure 85
3.6.1 Respondent Driven Sampling , .85
3.6.2 Snowball Sampling 86
3.6.3 Makeshift Outreach Method 86
3.7. Data Collection Methods 87
3.7.1 Interview Schedule 87
3.7.2 Anthropometric Measurements 87
3.7.3 Tuberculosis Diagnostic Methods 89
3.7.3.1 Collection of Sputum 90
3.7.3.2 TB Sputum for Acid Fast Bacteria (AFB) Microscopy 90
3.7.3.3 Drug Susceptibility Testing , .- 91
3.7.4 Hl V Testing 93
3.7.4.1 Blood Collection " 93
3.7.4.2 RNAExtraction and Quantitation ofHIV-l Viral Load 94
3.7.4.3 Reverse Transcriptase-PCR 94
3.7.4.4 DNA Purification and Sequencing 95
3.7.5 Hematological Profile 96
3.7.6 CD4+ T Cell Enumeration 96
3.8 Vital Signs : 97
3.8.1 Body Temperature 97
3.8.2 Blood Pressure 97
3.9 Pilot Study 97
3.10 Inclusion Criteria '" 98
VlIl
3. J ) Exclusion Criteria 98
3.13 Ethical Consideration 98
3.14 Data Analysis 99
CHAPTER FOUR: RESULTS AND DISCUSSION IOI
4.1 TIle Social-demographic Characteristics and Sexual Practices of the PWID
in Mombasa County '" .10]
4.2 Drug Use Patterns of my Infected and non Infected IDUs
of Mombas a County ]09
4.3 Association of Socio-demographic, Sexual Practice and Drug Use
Patterns in Relation to my Status 113
4.4 Nutritional Measures of the PWID in Mombasa County .117
4.5 The Prevalence of Pulmonary TB Infections among my Uninfected
and Infected IDUs in Mombasa County .124
4.6 The HlV Subtypes that Cause my Infections in IDUs Living in
Mombasa County , , .129
OlAPTER FIVE: CONCLUSION AND RECOMMENDA TIONS .......•........ ~132
5.1 Conclusion 132
5.2 Recommendations 133
5.3 General recommendations ] 37
5.4 Suggested Further Research 139
REFERENCES 140
APPENDICES ] 88
Appendix 1: Map of Kenya and Mombasa County 188
Appendix 2: Interview Schedule , , , .. , 189
Appendix 3: ERC Clearance 193
Appendix 4: Ministry of Health, Mombasa County Clearance .195
Appendix 5: Consent Form- English Version ] 96
Appendix 6: Consent Form- Swahili Version 197
Appendix 7.:PCR Protocol 198
Appendix 8: Work Plan 199
Appendix 9: Budget: Data Collection Costs 200
IX
LIST OF TABLES
Table 3.1: Critical concentrations of first-line drugs 92
Table 4.1: Socio-dernographic characteristics ofPWID in Mombasa,
Kenya, 2012-2013 102
Table 42: Sexual practices ofPWID in Mombasa, Kenya,
in2012-2013 103
Table 4.3: Drug use patterns among IDUs in Mombasa, Kenyan
in 2012-2013 110
Table 4.4: Association of the socio-demographic characteristics, sexual
. practices and drug use patterns in relation to IDUs Hl V status,
. in Mombasa County 2012-2013 115
Table 4.5: Nutritional Status ofHIV-l infected and uninfected IDUs in
Mombasa County, 2012-2013 .119
Table 4.6: Predictors of malnutrition in HlV-I infected and uninfected
injection drug users in Mombasa County, 2012-201 120
Table 4.7: Tuberculosis prevalence rate among PWID in Mombasa
County, 2012-2013 125
Table 4.8: Predictors of tuberculosis among IDV-l uninfected IDUs
in Mombasa County, 2012-2013 .126
Table 4.9: Predictors of tuberculosis among HlVvl infected PWID in
Mombasa County, 2012-2013 .127
Table 4.10: HIV subtypes circulating in Mombasa IDUs 130
xLIST OF FIGURES
Figure 1.1: The Conceptual Framework 9
Figure 2.1: Chemical structure of heroin (diacetylmorphine) , 13
Figure 2.2: Chemical structure of Cocaine 18
Figure 2.3: Chemical structure of Cathinone , 22
Figure 2.4: Chemical structure ofCathine 24
Figure 2.5: Chemical structure of Nicotine 27
Figure 2.6: Chemical structure of Tetrahydrocannabinol.. .30
Figure 2.7: Chemical Structure of Rohypnol (Flunitrazepam) .35
Figure 2.8: Chemical structure of Ethyl Alcohol .38
Figure 3.1: Map of Kenya and Mombasa County , 83
XI
LIST OF PLATES
Plate 2.1: Opium poppies (Papaver somniferumj 12
Plate 2.2: Coca Plant (Erythroxylum coca) .l9
Plate 2.3: Khat Plant (Catha edulis) .23
Plate 2.4: Tobacco plant (Nicotiana tabacum) .26
Plate 2.5: Marijuana Plant (Cannabis sativa Linneaeus) .31
XII
LIST OF APPENDICES
Appendix 1: Map of Kenya and Mombasa County J 99
Appendix 2: Interview schedule 200
Appendix 3: Ethical review clearance .204
Appendix 4: Ministry of Health clearance .206
Appendix 5: Consent form- English version 207
Appendix 6: Consent form- Swahili version 208
Appendix 7: HIV testing protocol.. , 209
Appendix 8: Work plan 210
Appendix 9: Budget 211
AFB
AIDS
ART
ARV
BMI
BMT
CDC
CESAR
CI
CMI
CNS
CRF
DEA
DFSA
DST
ECDC
EMCDDA
ERC
FANTA
FAO
FDA
GABA
XlII
ABBREVIATION/ACRONYMS
Acid Fast Bacteria
Acquired Immune Deficiency Syndrome
Antiretroviral Therapy
Antiretroviral
Body Mass Index
Buprenorphine Maintenance Treatment
Centre for Disease Control
Centre for Substance Abuse
Confidence Interval
Cell Mediated Immunity
Central Nervous System
Circulating Recombinant Forms
Drug Enforcement Administration
Drug Facilitated Sexual Assault
Drug Sensitivity Test
European Centre for Disease Prevention and Control
European Monitoring Centre for Drugs and Drug Addiction
Ethics Review Committee
Food and Nutrition Technical Advisor
Food and Agriculture Organization
Food and Drug Administration
Gamma aminobutyric acid
GABAA
HBC
HBV
HCV
mv
IBM
ICHRA
IDSA
IDU
XIV
Gamma-aminobutyric acid-A
High-Burden Countries
Hepatitis B virus
Hepatitis C Virus
Human Immunodeficiency Virus
International Business Machines
International Centre for Health Interventions and Research in Africa
Infectious Diseases Society of America
Intravenous Drug Use! Injection Drug Use
IDUs Intravenous Drug users! Injection Drug Users
lliRA International Harm Reduction Association
IQR Inter-Quartile Range
IRIN Integrated Regional Information Networks
KAIS Kenya AIDS Indicator Survey
KFSSG Kenya Food Security Steering Group
KNBS Kenya National Bureau of Statistics
LJ Lowenstein-Jensen
UvlIC Low and Middle Income Countries
MDR Multidrug Resistant
METHOIDE Methamphetamine and Other Illicit Drug Education
MMT
MOH
NACADA
Methadone Maintenance Treatment
Ministry of Health
National Agency for the Campaign against Drug Abuse
NACC
NASCOP
NCDs
NIDA
NIH
NMDA
NPlN
NTFIC
NUUA
OR
OST
PLWA
PLVlHA
PWID
RDS
SA
SAMHSA
SIF
SIV
SNEP
SPSS
SW
SSA
xv
National AIDS Control Council
National AIDS and STI Control Programme
Non Communicable Diseases
National Institute on Drug Abuse
National Institutes of Health
N-methyl-D-aspartate
National Prevention Information Network
National Tobacco Free Initiative Committee
New South Wales' Drug User & AIDS Association's
Odds Ratio
Opioid Substitution Treatment
People Living With AIDS
People Living With mV/AIDS
People Who Inject Drugs
Respondent Driven Sampling
South Africa
Substance Abuse and Mental Health Services Administration
Supervised Injecting Facilities
Simian Immunodeficiency Virus
Syringe and Needle Exchange Programme
Statistical Programme for Social Scientists
Sex Worker
Sub Saharan Africa
TB
VCT
THC
TISS
UNAIDS
UNODC
USA
USAID
USDA
WFP
WHES
WHO
WHR
XVI
Tuberculosis
.Voluntary Counseling and Testing
Tetrahydrocannabinol
Tata Institute of Social Sciences
Joint United Nations Programme on HlV and AIDS
United Nations Office on Drugs and Crime
United States of America
United States Agency for International Development
United States Department of Agriculture
World Food Programme
World Hunger Education Service
World Health Organization
Waist to Hip Ratio
XVll
DEFINITION OF TERMS
Intravenous/injection drug user: A person who uses recreational drugs that are
administered via the vein. The two terms have been used interchangeably in this study.
Blood loaning: A practice in which an IDU who cannot afford to purchase heroin injects
the blood of another IDU who recently injected, in the belief that the blood contains
heroin and thus can prevent withdrawal symptoms.
Cooker: Any small container, usually a spoon or a bottle cap, used to dissolve the
injectable drug, most often in powder form.
Drugs: A chemical, often an illegal substance that causes addiction, habituation, or a
marked change in consciousness.
Flush-blood: the practice of deliberately drawing blood into a syringe and reinjecting
the blood-drug mixture.
Recreational drug use: The non medicinal use of a substance (legal, controlled, or
illegal) with the intention of enhancing life (increasing euphoria, blocking unhappy
memories, or creating pleasure).
Undernutrition: Insufficient provision of energy and nutrients, such as good quality
protein with an adequate balance of essential amino acids, vitamins and minerals, and an
inability to meet the requirements of the body to ensure growth, maintenance, and
specific functions.
Serosorting: A decision to share or not to share injection equipment based on the
partner's Hl V status.
Sex fur police protection: Occurs when vulnerable groups like injection drug users
offer sex to policemen in order to avoid being arrested.
XVlll
ABSTRACT
Both injection drug use (IDU) and HfV are major global public health problems. The
link between IDU and Hl V arises from high risk injecting and precarious sexual
behaviour. Data on the socio-demographics, drug use patterns, tuberculosis (TB)
prevalence, nutritional status and Hl V sub-types is inadequately documented in Kenyan
IDUs. This cross sectional study sought to determine the factors that predict HIV and
Pulmonary TB among IDUs in Mombasa County. At Bomu Hospital 371 IDUs (HIV
infected, n= 157) were enrolled using respondent driven sampling, snowball and make
shift methods. The study was approved by Kenyatta University Ethics Review
Committee and conducted according to the Helsinki declaration. Written informed
consent was obtained from each participant. Structured interview schedule was used to
capture the socio-demographic characteristics and drug use patterns. Nutritional status
determined using anthropometric indices. One spot and two early morning sputa were
obtained on three consecutive days for TB microscopy and culture. HIV status was
established by two parallel rapid antibody tests. mV-I pro-viral DNA was extracted
from plasma, amplified using gag-pol primers and amplicons were sequenced from
Stanfurd HIVdb database. Using SPSS version 20, Pearson's Chi-square, Fisher's exact,
Mann-Whitney tests and binary logistic regression were utilized as appropriate. Socio-
demographic predictors of Hl V-1 infection were being female, sex work or working in
entertainment venues, having more than five sexual partners, sex without a condom, sex
for police protection and exposure to SIl, all at P <0.0001. In addition marital
separation and sex for drugs increased the odds ofHIV infection at P <0.001. Although
heroin was the most common drug at 81.7%, a vast majority of IDUs were
polysubstance users. Use of Rohypnol for recreational purposes was rampant at 55.3%.
Alcohol, khat and cocktail consumption predicted higher odds of Hl V infection at P
<0.0001,0.007 and 0.004 respectively. On the other hand, any use of heroin or cocaine,
having injected for more than three years as well as polydrug use of heroin or cocaine
alongside any other four substances were predictive of Hl V infection, all at P <0.0001.
High levels of undernutrition were reported in this sub-population with Hl V infected
IDUs faring worse on height and MUAC at P <0.001 and P <0.0001 correspondingly.
Additionally, having a CD4 count of less than 500 cells/ul. increased the odds of
undernourishment. A CD4 of less than 500 cells/ul. and or BMJ equal or below 18.5
kglm1augmented the odds of contracting TB irrespective of HIV status. Nonetheless
mv infected IDUs were at a higher risk of TB infection than the uninfected at P
<0.0001. There were nine Hl V sub-types including their recombinant forms circulating
namely AI, A2_AG, AID, A2C, ABDU, B, C, D and G with Al being the most
dominant. This study has demonstrated the association between drug use, TB and Hl V
infections, therefore there is need to integrate H1V and TB screening as well as nutrition
supplementation in drug prevention and management programmes. These findings will
influence the planning and resource allocation for targeted intervention among IDUs
both at National and County Government levels in order to mitigate the impact of drug
abuse as well as achieve the MDGs one to six. In addition, continuous surveillance of
themv and TB epidemiology is imperative. These interventions are key to Kenya's
achievement of zero new H1V infections and AIDS-related deaths initiative.
CHAPTER ONE: INTRODUCTION
1.1 Background to the study
Injection Drug Users (IDUs) also known as People Who Inject Drugs (PWID) are among
the groups most affected by the Human Immunodeficiency virus (HIV) and Acquired
Immune Deficiency Syndrome (AIDS) since the epidemic began almost over three
decades ago. The link between injection drug use and HIV arises from sharing of needles,
syringes, water mixing spoons, practicing flashblood and engaging in high risk sexual
behaviour (McCurdy et af., 2010; Uuskula et al., 2010; Ulibarri et aI., 2011; CDC,
2012a; NASCOP, 2012a). Consequently, injection drug use is one of the most efficient
avenues of transmitting HIV and other blood-borne pathogens like Hepatitis B Virus
(HBV) and Hepatitis C Virus (HCV), that spread rapidly through IDU populations and
their sexual partners (Cavlek et aI., 2011; Orsetti et aI., 2013; WHO,2013a).
Although injection drug use has previously been perceived as a European and Asian
problem, evidence indicates that drug use is on the increase on the African continent. In
particular the coastal cities of Nigeria, Tanzania, Kenya and South Africa are the most
affected (UNODC, 20 13a). Due to the illicit nature of drug use and the associated stigma,
it is difficult to obtain the exact data on PWID (Needle et al., 2005) however, Mombasa
is estimated to have an IDU population of about 26,000 persons (IRIN, 2012; NASCOP,
2012a). Previous studies carried out and reports show that there is steady increase of
injection drug use in Kenya (Odek-Ogunde et al., 2003; Beckerleg and Hundt, 2004;
Ndetei,.2004; Needle et al., 2005; Beckerleg et al., 2006; Deveau et al; 2006). Currently
2coastal towns (Mombasa, Lamu and Malindi) as well as Nairobi are the most affected
(IRIN, 2012; NASCOP, 2012a).
Globally the most common injectable drugs are amphetamines, opioids (including,
heroin) and cocaine (UNODC, 2011a). In Kenya, the commonly used injecting drugs
include heroin, cocaine and methamphetamine (NACADA, 2012). In Mombasa, heroin
has been a street drug for over 30 years. During the 1980s, heroin (the brown sugar
version) quickly spread from Mombasa to smaller coastal towns like Malindi and
Watamu (Beckerleg et al., 2006). Brown sugar was mostly used through inhalation of its
vapour. In 1998, the injectable heroin (white crest) started to replace brown sugar. Hence
by the late 1990s, heroin users were shifting from brown sugar to white crest (Beckerleg,
2004).
High risk injecting trends and sexual behaviour has been extensively documented among
PWIDs. These include sharing of syringes, needles and water mixing spoons, practicing
of flashblood, blood loaning, unprotected sex with partners of unknown HIV status and
anal sex (McCurdy et al., 2006; McCurdy et al., 2010; Cavlek et al., 2011). Additionally,
multiple sexual partnerships, sex for drugs, group sex, sex for money to buy drugs or for
drugs, sex for police protection is well documented in this sub-population (Parry et al.,
2008; Williams et al., 2009; Brodish et aI., 2011; Majidpour et aI., 2012). Moreover,
most PWID face drug-driven impaired judgment which reduces their negotiation power
for safer sex (McCurdy et al., 2010; Uuskula et aI., 2010; Ulibarri et al., 20] 1; NASCOP,
20 12a). As a result the prevalence rate of HIV among IDUs globally is alarmingly high.
3In Kenya for instance, previously the HlV prevalence among IDUs ranged between 43%
- 49% (Deveau et al., 2006; Needle and Zhao, 2010) as opposed to the then national adult
prevalence of 7.1 % (KAIS, 2007). Currently this prevalence has come down to 18% but
remains high when compared to the national adult prevalence of 6.2% (NASCOP, 2013).
Drug abuse has been linked to poor nutritional status attributed to impaired nutrient
absorption or altered appetite or metabolism (Hendricks et al., 2010; Vogenthaler et al.,
2010; Tang et al., 2011). Undernutrition increases the risk of Hl V transmission or
acquisition by compromising ones immune status as well as gut and genital mucosal
integrity (Weiser et al., 2008; Olsen et al., 2014). Drug use, HfV infections and
undernutrition lower immunity thus increasing the risk of reactivating latent tuberculosis
(TB) to active TB infection in addition to exacerbating progression of HIV to AIDS
(Drake, 2010; Shalini et al., 2012; Mamani et 01.,2013; Padmanesan et of, 2013).
Both IDUs and non-IDUs are at a risk of developing TB due to the overlap of
epidemiological and social factors associated with both drug use, Hl V and TB (Deiss et
al., 2009; CDC, 2012d; Ruutel et 01.,2012). Globally, nearly 2 billion people are infected
with TB. People living with mY/AIDS (PLWHA) are more likely to develop active TB
in a given year than HlV sero-negative persons due to their weakened the immune system
(USAID, 2013; WHO, 2013a). Currently about 34 million people are living with HIV and
at least one third are co-infected with TB. Kenya ranks thirteenth on the list of twenty
two TB High Burden Countries (HBCs) in the world and has the fifth highest burden in
Africa, These 22 HBCs account for 80% of the global TB burden (WHO, 2013b). In
4Kenya, the prevalence ofTB among HIV sero-positive patients was 44% in 2009 (WHO,
2009a; CDC, 2011a) and presently it ranges between 38.3% and 39% (MOH, 2012;
MOH, 2013).
The HIV-TB co-infection is a major problem in Sub-Saharan Africa (SSA) and is
commonly called the deadly duo. TB infections enhance Hl V replication at the same time
accelerates Hl V progression to AIDS. The overlap of HIV- TB co-infection with MDR-
TB and extensively drug-resistant TB presents a tremendous challenge and threatens
progress in controlling TB and HIVI AIDS as well as in eliminating the mortality
associated with these diseases (USAID, 2013; WHO, 2013b). In Kenya, out of the total
samples received and processed, 225 were resistant to both Isoniazid and Rifampicin
(MOH, 2012). Elsewhere, outbreaks of drug-susceptible and MDR-TB have been
reported among PWID (Deiss et al., 2009) but this data is scanty in Kenya.
1.2 Statement of the Problem
Despite the fact that previous studies have shown that PWID are more predisposed to
HIY than the general population, injection drug use remains a major public health
challenge. Approximately, there 16 million PWID globally out of which 3 million are
HIV infected. Globally, injection drug use accounts for at least 10% of new HIV
infections (Riley et al., 2005; WHO, 2013a). The HIV prevalence among PWIDs in
Kenya estimated to be 18.3% is by far much higher than the national prevalence of 6.2%
(NASCOP, 2008, NASCOP, 2013, NASCOP, 2014). In addition, an estimated 4% of
new my infections are linked to injection drug use with Coastal Kenya leading at 17%
5(NASCOP, 2008). The high risk of HIV acquisition and transmission in PWID largely
arises from unhygienic injecting and precarious sexual practices.
Although injection drug use is a global problem, Africa is a more recent victim as it acts
as a conduit of drugs from South America en route to Europe and Asia. In the process
some of the drugs find their way into the local market due to laxity in enforcing drug
related laws as well as corruption (UNODC, 2013a). In Kenya, more so Mombasa, drug
abuse has been linked to the proximity of the port, corruption, poverty, pouching,
radicalization and breakdown in family structure.
People who inject drugs like other drug users are undernourished. Undernourishment
arises from food insecurity, misplaced priorities, reduced food intake and mal-
absorption(Anema et aI., 2010 and Tang et al., 2011). Under nutrition on its own leads to
reduced CD4 and CD8 T-lymphocyte number (Drake 2010). This impairs cell-mediated
immunity (CM!) which is the principle host defense against TB (Shalini et al., 20]2).
Undernutrition irrespective of the cause increases the risk of opportunistic infections and
exacerbates progression from HIV to AIDS (Cegielski et al., 2010; Padmanesan et at,
2013). Due to overlap of epidemiological factors like poverty and overcrowding, PWID
are therefore at a greater risk of contracting both HIV as well as TB infections (Deiss et
aI., 2009; Ruutel et af., 2012).
In addition, criminalization of drug use has led to marginalization of IDUs. Therefore,
IDUs who are infected with either HIV or TB or both are less likely to access healthcare
6and adhere to respective drug regiments. Poor adherence reduces efficacy of medicinal
drugs at the same time increases the probability of developing multi-drug resistance
(Muture et aI., 2011; CDC, 2012a; ELF, 2012; Dutta et al., 2013).
In this regard, the IDU, HIV, malnutrition and TB burden is immense as well as complex.
Elsewhere, determinants of HIV and TB among PWID have been identified as socio-
demographics, drug use patterns, low BMl and low CD4. However, these factors are
scantly documented in the Kenyan context. Unless these factors are identified and dealt
with through targeted interventions, Kenya may not achieve most of the sustainable
development goals.
1.3 Research questions
1. What are the social-demographic characteristic of an IDU population?
2. What are the drug use patterns ofIDUs?
3. What is the nutritional status ofIDUs?
4. What is the TB prevalence rate in IDUS?
5. What are the HIV subtypes causing HIV infections in IDUs?
1.4 ,Null hypotheses
I. Social-demographic characteristics are similar between HIV infected and
uninfected IDUs.
2. Drug use patterns are invariable between HIV infected and uninfected IDUs.
3. Nutritional status is incomparable between HIV infected and uninfected IDUs.
74. TB infection rate does not vary with HlV infection ill IDUs.
5. Single HIY subtype do not cause HIY infection in IDUs.
1.5 General objective
To determine the factors that predicts HIY and Pulmonary TB infections among lDUs in
Mombasa County.
1.6 Specific objectives
1. To describe the social demographic characteristics ofIDUs in Mombasa County.
2. To determine drug use patterns of the IDUs in Mombasa County.
3. To assess the nutritional status of the lDUs in Mombasa County.
4. To establish the TB prevalence in the IDUs in Mombasa County.
5. To identify the HIY subtypes causing HIY infections in the IDUs in Mombasa
County.
1.7 Justification
Due to scanty information on the impact of injection drug use on the upsurge of HIY
infections and related co-morbidities among the PWID in Kenya, the study was necessary
in order to identify the predictors of HIY and TB among IDUs. This was further
necessitated by the fact that risk of TB infections among IDl!s is due to an overlap of
epidemiological and social factors associated with both drug use, HIV and TB. In
addition, the adequate control of the HIV and TB syndemic in IDUs, non-IDUs and the
non drug users is the key to the long-term TB elimination target set for 2050. It was
8therefore important to delineate the factors that predict HIV and TB infections in the IDU
subpopulation by establishing the epidemiology of HlV and TB among IDUs in Kenya.
Findings of this study will contribute to planning and resource allocation for targeted
intervention among IDUs both at National and County Government levels in order to
mitigate the impact of drug use as wellas achieve the MDGs one to six.
1.8 Limitations
Due to stigma and the illegal nature of drug use, drug users in Kenya are hidden and were
difficult to reach. It was even more difficult to access and enroll female IDUs. Tills
limitation was overcome by working closely with various psychosocial support groups of
sex workers. Since the study design was cross-sectional, it is difficult to know the time-
point of HIV acquisition. A longitudinal approach would have yielded detailed
information on sexual practices and drug use patterns. Drug llse patterns were self-
reported as no urinalysis was carried out, hence the complete set of injection and non-
injection drugs used by the study participants are unknown. Furthermore, self-reported
exposure to STIs and sexual practices may be confounded by recall bias.
1.9 Conceptual framework
Injection drug use in Kenya has become increasingly recognized as a public health
problem, particularly in light of its association with needle sharing and undernutrition.
IDUs are vulnerable to undernutrition, overcrowding and poverty. These increase the risk
for both TB and HIV/AIDS infections. Most IDUS on one hand are less likely not to
adhere to both antiretroviral and anti TB drugs while on the other hand they are more
9likely to engage in high risk sexual behaviour such as sex work (either heterosexuality or
homosexuality or bisexuality or group). Consequently, the prevalence rate oflITV and TB
in the IDU population is significantly higher than that of the general population. These
factors are illustrated in Figure 1.1
Independent variables
High risk injecting &
sexual nractices
Impaired judgment
Mono or Polysubstance
Use
STIs
Female Gender
Dependent variables
HIV & Co-morbidities e.g.
HBV,HCV&TB
Intermediate variables Dependent variable
TB, Faster disease
progression & high
mortality rate
Under Nutrition,
low CD4 count &
poor adherence
Figure 1.1 Conceptual Framework (Source: literature review)
10
CHAPTER TWO: LITERATURE REVIEW
2.1 Over View on Drugs Abused by Participants
Drug abuse refers to the harmful or hazardous use of psychoactive substances for mood-
altering purposes. 1t can also be defined as the use of illicit drugs or the abuse of
prescription or over-the-counter drugs for purposes other than those for which they are
indicated or in a manner or in quantities other than directed (Medline Medical
Encyclopedia, 2014; WHO,2014a).
Addiction is the repeated use of a psychoactive substance or substances, to the extent that
the user (referred to as an addict) is periodically or chronically intoxicated, shows a
compulsion to take the preferred substance (or substances), has great difficulty in
voluntarily ceasing or modifying substance use, and exhibits determination to obtain
psychoactive substances by almost any means (WHO, 2014a). It can also be defined as a
chronic, relapsing brain disease that is characterized by compulsive drug seeking and use,
despite harmful consequences. It is considered a brain disease because drugs change the
brain, its structure and how it works. These changes can be long lasting and harmful,
often leading to self-destructive behaviours (NIDA, 2012).
Based on these definitions, the study focused on recreational drugs in the context of use
of illegal substance(s) and pharmacological preparation (s) that is (are) taken voluntarily
for personal pleasure or satisfaction rather than medicinal purposes. In addition the term
drug and substance have been used as synonyms. Borrowing from both National Institute
on Drug Abuse (NIDA) and Drug Enforcement Administration (DEA) recreational drugs
11
classification systems, drugs in this study were discussed under following topics:
narcotics, stimulants, cannabinoids, depressants and alcohol. Dissociative anesthetics,
hallucinogens, inhalants and anabolic steroids have not been discussed as use of these
drugs was not reported by the participants (DEA 20]]; NIDA, 20]2).
2.1.1 Narcotics
The word narcotic is derived from the Greek word narke (meaning stupor) and is used.to
descnbe opium, opium-based derivatives and synthetic substitutes. They include opium,
heroin, morphine, codeine and other opioid derivatives (DEA Museum, 2012; Opium,
2014). Narcotics have been useful in the practice of medicine for relief of intense pain
since they are the most effective analgesics known. Although narcotic substances are
available for medical use like in treatment of pain, epilepsy and opioid dependence, their
access is controlled and limited (WHO, 2010). With respect to the context of this study,
the literature review was restricted to recreational use of heroin but with a brief
introduction to opium and morphine.
Opium, the first opioid, is derived from the sap of opium poppies (Papaver somniferumj
and is obtained as the dried milky juice (Plate 2.1). Its use dates back to around 3400 BC
among the Sumarians who lived in lower Mesopotamia (now western Iraq). By 1300 BC,
the Egyptians were cultivating poppies for the production of opium. The opium they
produced was an extremely popular commodity that they traded it as far away as Greece
and central Europe (Rosso, 2010; Flaseha, 2011). During the 18th century physicians in
the United States of America (U.S.A) used opium as panacea (Hays, 2011).
12
Plate 2.1: Opium poppies (Papaver somniferum)
Source: Plant & Flower Encyclopedia (Botany.com)
2.1.1.2 Morphine and Codeine
In 1805, morphine was used as a cure for opium addiction smce its addictive
characteristics were not known. Morphine was used widely as a painkiller during the
American Civil War and many soldiers became addicted. Codeine, a less powerful form
of opium but can be synthesized was first isolated in 1830 in France by Jean-Pierre
Robiquet to replace raw opium for medical purposes. It was used mainly as a cough
remedy (DEAMuseum, 2012; UNODC, 2014a).
13
2.1.1.3 Heroin
In 1874, German scientists developed a formula for a painkiller that they thought would
be less addictive than morphine. They simply added two acetyls to morphine to form
diacetylmorphine (commonly known as heroin). It was produced and marketed
commercially in 1898 by Bayer Pharmaceutical Company as a panacea. Heroin is also
converted into morphine once in the body. When used in medicine, it is typically used to
treat severe pain, such as that resulting from a heart attack or a severe injury (Bergstrom,
2002; Scott, 2012). The chemical structure of heroin is illustrated in figure 2.1.
HC-C-O
3 II
o
Figure 2.1: Chemical structure of heroin (diacetylmorphine)
Source: EMCDDA, 2013a
Currently United Nations Office on Drug and Crime (UNODC) estimates that there are
between 12 and 21 million opiate users worldwide. Globally heroin is the most
commonly used opiate. Heroin is manufactured from opium poppies cultivated in four
primary source areas namely South America, Southeast and Southwest Asia and Mexico.
14
Europe and Asia have been reported as the key opiate consumption markets. Afghanistan
remains the highest producer of opium with an estimated acreage of about 123,000 ha in
2012, that is74% of global cultivation (UNODC, 2013a). Although heroin is not
cultivated in Africa, it remains the most commonly used illicit injection drug in Tanzania
and Kenya (Ross et a/., 2008; Brodish et al., 201 I; Ratliff et al., 2013).
Heroin is distributed in three forms namely brown, white and black tar heroin. It can be
injected into a vein ("mainlining") or a muscle, smoked in a water pipe or standard pipe,
mixed in a marijuana roll or regular cigarette, inhaled as smoke through a straw ("chasing
the dragon,") or snorted as powder. It can also be injected under the skin also known as
skin popping (Ciccarone, 2009; NIDA 20 13a; Drug policy Alliance, 2014).
Brown heroin also known as brown sugar is pr.oduced mainly in the Golden Crescent
(Afghanistan, Pakistan and Iran). It is less refined and burns at a lower temperature than
white heroin making it ideal for smoking. When smoking, a small amount of heroin is
placed on a piece of silver foil and heated from below. The heroin turns into a liquid and
gives off a curl of smoke. This curly smoke is inhaled through a rolled tube of paper or
straw, a practice referred to as chasing the dragon (Ciccarone, 2009; CESAR, 2013;
NUDA, 2014; UNODC, 2014b).
White heroin is the most refined heroin often referred to as grade four heroin. It is
produced mainly in the Golden Triangle (Burma, Laos and Thailand). The process of
preparing heroin for injection can be done either heating heroin mixed with water in a
15
spoon over a flame ("cooking"). Alternatively it can be by dropping the heroin powder
with water directly into a syringe and then applying flame from a lighter directly to the
syringe (CESAR, 2013; Ciccarone, 2009; NUUA, 2014; UNODC, 2014b).
Black tar heroin is sticky like roofing tar or hard like coal. It is predominantly produced
in Mexico and sold in areas west of Mississippi River. The dark color associated with
black tar heroin results from crude processing methods which leave behind impurities.
This impure heroin is usually dissolved, diluted and injected (Maxwell and Spence 2008;
Dickson et al., 2010; NIDA 2014). Black tar heroin use among PWID has been linked to
an increased number of cases of wound botulism, tetanus and necrotizing soft-tissue
infections due to Clostridia (Kimura 2007; Yuan, 2011).
Those who inject heroin use a set of paraphernalia like hypodermic needles, small cotton
balls, spoons or bottle caps for heating or liquefying the drugs and a "tie-off" that the user
wraps around their arm to make the veins protrude. Paraphernalia for sniffing or smoking
include razor blades, straws and pipes (EMCDDA, 2013a; Palmateer et al., 2014).
Following injection, heroin crosses the blood-brain barrier within 20 seconds, with
almost 70 % of the dose reaching the brain. Once heroin enters the brain, it is converted
tomorphine and binds to opioid receptors. There are three main opioid receptors: delta,
kappa and mu. They occur throughout the central nervous system (CNS), in some sensory
nerves, on mast cells and in a few gastrointestinal tract (GIT) cells. Opioid receptors are
alsolocated in the brain stem which is important for vital processes like breathing. blood
pressure and arousal (EMCDDA, 2013a; CESAR, 2013; Feng et al., 2012).
16
2.1.1.3.1 Effects of Heroin
Apart from analgesia, positive effects of diamorphine include drowsiness, euphoria and a
sense of detachment. Negative effects include respiratory depression, weakened immune
system, nausea, vomiting and decreased motility in the gastrointestinal tract. Moreover,
heroin use leads to cough reflex suppression, hypothermia, tooth decay, inflammation of
the gums, constipation, muscular weakness, partial paralysis, memory loss, impaired
intellectual performance, introversion, depression as well as pustules on the face (Blum et
al., 2013; EMCDDA, 2013a, NlDA, 2013b).
Besides, heroin addiction has been linked to reduced sexual capacity, menstrual
disturbance in women, inability to achieve sexual orgasm (in both women and men), drug
induced anorexia, insomnia and coma (Schmidt et al., 2013; UNODC 2014c). Long term
effects include tolerance, physical dependence and overdose. Heroin is associated with
far more accidental overdoses and fatal poisonings than any other scheduled substance
(Bang-Ping, 2009; Chekuri, 2011; Cioe et al., 2013; EMCDDA, 2013a; NIDA, 2013b).
Sinceheroin is addictive, sudden cessation of use in tolerant subjects leads to withdrawal
syndrome also known as cold turkey. This may occur within 6 to 24 hours of
discontinuation of the drug. However time frame can fluctuate with the degree of
tolerance as well as the amount of the last consumed dose. Withdrawal symptoms include
coldsweats, general malaise, anxiety, depression, akathisia, priapism and extra sensitivity
of the genitals in females (Kenny, 2009; NIDAb, 2013). Further, excessive yawning or
sneezing, cramps, watery eyes, rhinorrhea, insomnia, myalgia, bone aches and chills have
JCEriYA A U IV•..••ul
17
been reported. Nausea, vomiting, diarrhea, fever, cramp-like pains and involuntary
spasms in the limbs are also common (EMCDDA, 2013a; Hartney, 2014).
2.1.2 Stimulants
Stimulants are drugs that excite any bodily function through stimulation of the brain and
central nervous system. They include cocaine, amphetamine, methylenedioxy-
methamphetamine (MDMA), methamphetamine and methylphenidate. This study
focused on cocaine, khat and nicotine.
2.].2.1 Cocaine
Coca is one of the oldest and most potent stimulants of natural origin. The ancient Incas
in the Andes chewed coca leaves to get their hearts racing and to speed their breathing in
order to counter the effects of Jiving on thin mountain air as far back as 3000 BC Natives
in this region chewed or brewed coca leaves into tea for refreshment and to relieve
fatigue similar to the customs of drinking tea or coffee (Gonzales, 2010; DEA Museum,
2012). Coca did not find use in Western medicine until the late 19th century when
American drug companies began to research on new medicines (Gonzales, 2010;
Gootenber, 2010; DEA Museum, 201.2). It was first extracted from coca leaves in 1859
by German chemist Albert Niemann. Later pure cocaine was isolated in the 1880s and
used as a local anesthetic in eye surgery. Many of its therapeutic applications are now
obsolete due to the development of safer drugs (Gootenber, 2010; Rankin, 2010).
18
Cultivation of coca is concentrated in Colombia, Peru and Bolivia. In 2011, the UNODC
estimated that the area under coca cultivation in 2010 amounted to 149 000 hectares
(UNODC, 2011a). Erythroxylum Erythroxylum coca (Plate 2.2) is the most popular
species in South America (Plowman, 2008; Hirst, 2014). Cocaine consignments to
Europe appear to be transited through Argentina, Brazil, Ecuador, Venezuela and
Mexico. In recent years, alternative routes through West Africa have been detected.
Coastal cities of East Africa are some of the most provenance regions (Parry et al., 2009;
Peltzer et al., 2009; EMCDDA and Europol, 2010; NACADA, 2010).
2.1.2.1.1 Forms of Cocaine
Cocaine (C)7H2IN04), whose chemical structure is shown in Figure 2.2 is usually
distributed in three forms. These are cocaine paste, the salt form (cocaine hydrochloride
also known as white crystalline powder) and freebase cocaine or crank: cocaine which is a
waxy solid that may be white, yellowish, or greyish. The physiological and psychoactive
effects of cocaine are similar regardless of its form (NIDA, 20 l3c; Watson 2014).
o
"C-O-CH3
oO-~-{)
Figure 2.2: Chemical structure of Cocaine
Source: EMCDDA, 2013b
19
Plate 2.2: Coca Plant (ErydlToxylum coca)
Source: DEA Museum, 2012
Cocaine paste also known as pasta basica de cocaina is the first crude extraction product
of coca leaves thus it is the least pure form of cocaine. The leaves are mashed with an
alkali like sodium bicarbonate and kerosene and then sulfuric acid or sometimes
potassium permanganate. The result is off-white or light-brown paste containing 40 to 70
percent cocaine, as well as other alkaloids, benzoic acid, kerosene residue and sulfuric
acid (NIDA, 2013c; UNODC, 2013a; Watson 2014).
20
Powdered form of cocaine (cocaine hydrochloride) is more pure than paste cocaine. It can
either be snorted or dissolved in water and injected into the bloodstream. It is odourless
and cannot be smoked because it is mostly destroyed by heat (Andreasen et aI., 2009;
EMCDDA, 20] 0; Hall et al., 2012; NIDA, 2012; Watson 20]4). Crank cocaine (freebase
cocaine) was first developed during the cocaine boom of the 1970's. It remains the most
popular drug, as it is inexpensive to produce thus cheaper to purchase than powder
cocaine. Powder cocaine when chemically changed to create crank cocaine can be
smoked or snorted but cannot be injected as it is not water soluble. It is called "crack"
because of the crackling sound it makes when smoked or rock (from forms ofsmaJl white
oryellowish rocks) and is the purest form of cocaine (CESAR, 2013; NIDA, 20I3c).
Cocaine irrespective of the version is a CNS stimulant that increases levels of dopamine
in brain circuits regulating pleasure and movement. Normally, dopamine is released by
neurons in these circuits in response to potential rewards. It is then recycled back into the
cell that released it thus shutting off the signal between neurons. Cocaine prevents the
dopamine from being recycled causing excessive amounts to build up in the synapse.
This amplifies the dopamine signal and ultimately disrupts normal brain communication.
It is this flood of dopamine that causes cocaine's characteristic euphoria (Blaylock et aI.,
2011; Blaylock et al., 2012; NIDA, 2013c; Xiea, 2014).
2.1.2.1.2 Effeds of cocaine
Cocaine produces euphoria, appetite suppression, altered metabolism, agitation, anxiety,
constricts blood vessels, irregular menses in women, increased energy, mental alertness,
21
tremors, irritability, aggressiveness and paranoia (Dinis-Oliveira, 2012; NIDA, 20 13c). It
also triggers hypertension, hyperthermia, tachycardia, arrhythmias, acute coronary
syndrome, myocardial infarction, increased risk of coronary diseases, cardiomyopathy,
stroke and psychosis (Ersche et al., 2010; CESAR, 2013; EMCDDA, 2013b)
Repeated use of cocaine leads to tolerance, addiction, loss of the sense of smell,
nosebleeds, severe bowel gangrene as a result of reduced blood flow, Fournier's
gangrene, priapism and undernutrition (Ersche et al., 2012a; Khan et la., 2013;
Nidimusili et aI., 2013). Cocaine is more dangerous when combined with other drugs.
For example, the combination of cocaine and heroin (known as a speedball if injected or
moonrocks when snorted) carries a particularly high risk of fatal overdose (NIDA, 2013c;
Trujilloa, 2011). The withdrawal symptoms associated with cocaine are unlike those
related to opiates. The body does not become physiologically dependent, but they may
produce a state of acute unease or discomfort, enhanced anxiety, depression, fatigue,
insomnia and craving for more cocaine (El Hage et al., 2012; UNODC, 2014d).
2.1.2.2 Khat
Khat is a stimulant drug derived from Catha edulis, a native plant of East Africa and
southern Arabia. It is also known by street names like qat, quat, gat, jaad, chat and
miraa. Most- of the effects of chewing khat come from the two phenylalkylamines
(cathinone and Cathine) which are structurally related to amphetamine (EMCDDA,
2011a; Brenneisen et al., 2012). Khat (Plate 2.3) is not scheduled under the Controlled
Substances Act of the United States, but since cathinone, is a Schedule I drug (a
22
controlled substance with no recognized therapeutic use), the Federal Government
considers Khat use illegal (NIDA, 2013). In Kenya, khat has been listed as a drug by the
National Authority for the Campaign against Alcohol and Drug Abuse (NACADA,
20]3).
The principal active component in khat is S-cathinone, otherwise known as alpha
aminopropiophenone or S-(-)-2-amino-l-phenyl-l-propanone (Figure 2.3). Cathinone is
labile and is transformed within a few days of harvesting to a dimer (3,6-dimethyl-2,5-
diphenylpyrazine). It is considered a natural amphetamine as it produces
sympathomimetic and central nervous system stimulation analogous to the effects of
ampbetamine (Waleed, 2011; Wabe et al., 2012; CESAR, 2013).
o
Figure 2.3: Chemical structure of Cathinone
Source: EMCDDA, 20l3c
23
Plate 2.3: Khat Plant (Catha edulis)
Source: DEA Museum, 2012
Cathine (a norpseudoephedrine and phenylpropanolamine), is a further psychoactive
substance that arises from the metabolism of cathinone in plants (Figure 2.4). Cathine has
a milder psychostimulant action than cathinone and the effects last are short lived, so the
user must chew leaves almost continuously. Although it plays only a minor role in the
action of khat, cathine is responsible for the systemic effects like hypertension. The fresh
leaves contain a higher proportion of desirable cathinone but on drying, it breaks down
into Cathine (Krizevskiab et al., 2008; Dagne et al., 2010; EMCDDA, 2013c).
24
The constituents of khat have been shown to exert their effects on dopamine and
noradrenalin. It has also been postulated that like amphetamine cathinone releases
serotonin in the CNS. This increases the activity of the dopaminergic pathways. High
accumulation of dopamine in the brain can cause halluc.inations, schizophrenia, and
hypertension (EMCDDA; 20] Ia; CESAR, 2013; NIDA, 2013).
OH--
Figure 2.4: Chemical structure of Catbine
Source: EMCDDA, 2013a
2.1.2.2.2 Effects of Khat
Khat alleviates fatigue, reduces appetite while levels of alertness, euphoria, arousal and
motor activity are increased. Users can quickly develop a psychological dependency to
the drug, which increases their confidence, friendliness and contentment. Hallucinations,
insomnia, grandiose delusions, elevated blood pressure, impaired memory and cognitive
flexibility as well as paranoia have also been noted as side effects of using khat (CESAR,
2013; Getahun et al., 2010; NIDA, 2013; UNODC, 2014e). This may be followed by
depression, irritability, anorexia and difficulty in sleeping. Continuous use of high doses
25
may evoke psychotic reactions, spermatorrhoea, constipation and unne retention
(EMCDDA 2011, Zeleke et al., 20]3; NACADA, 2014). It is unclear whether khat
causes tolerance, physical dependency, addiction or withdrawal but long-term users have
reportedmild depression, nightmares and trembling after ceasing to chew (NIDA, 2013).
2.1.2.3 Nicotine
Nicotine is named after the tobacco plant Nicotiana tabacum, which in turn is named
after Jean Nicot, a French ambassador to Portugal. He used to send tobacco from Brazil
toParis in 1560 as well as promoted its medicinal use (Van Hoof, 2011). Tobacco began
growing in the Andes of South America about 6,000 B.c. It was used for religious and
medicinal practices although not on daily basis. Tobacco was hailed as a panacea as there
were claims it was effective against a host of disorders (Borio, 2010; Zagorevski and
Newman, 2012; Hirst, 2014).
Tobacco.is native to the subtropical and tropical Americas but there are a few species
indigenous to selected areas of Africa. There are over sixty species but the most common
are Nicotiana tabacum (Plate 2.4) and Nicotiana rustica (Moon et al., 2009;
Denduangboripant et al., 2010; Van Hoof, 201]; Encyclopaedia of Life, 2012).
26
Plate 2.4: Tobacco plant (Nicotiana tabacum)
Source: Encyclopaedia Britannica Online
Tobacco leaves and the smoke generated when they are burned contain over four
thousand chemicals, the best known of which is nicotine (the active ingredient
responsible for addiction). Nicotine was first extracted in 1807 in Italy by the researcher
Gaspare Cerioli, who called it tobacco's "essential oil." The French chemist Louis-
Nicolas Vauquelin made the same discovery in 1809 without knowledge of Cerioli's
work. However it is Physician Wilhelm Heinrich Posselt and chemist Karl Ludwig
Reimann, who accomplished significant work in the extraction of nicotine (Erowid, 2010;
27
Nordqvist, 2013). Nicotine (3-[(2S)-I-methylpyrrolidin-2-yl] pyridine), as shown ill
Figure 2.5 is a colorless oily liquid alkaloid.
Figure 2.5: Chemical structure of Nicotine
Source: Pubchem
In Africa, the tobacco story began when it was imported from America by the
Portuguese. In 1560 Portuguese and Spaniards shipped tobacco to East Africa, where it
spread to Central and West Africa. By 1650s South Africa European settlers grew
tobacco and used it as a form of currency (BAT, 2010; Borio, 2010). In Kenya, tobacco
production can be traced back to 1935 when a tobacco industry was started by white
settlers in the then Nyanza province (Campaign for Tobacco Free Kids, 2013).
In Kenya, volume and value sales of tobacco have continued to increase with time partly
due to rising urbanization and changes in lifestyle especially among females where
28
smoking has became more acceptable. However, after passing the Tobacco Control Act
in 2007, the Kenyan govermnent began implementing enforcement of anti-smoking
campaigns. Smoking prevalence dropped for the first time in 2012, after rising steadily
before. Despite the decrease, non-communicable diseases (NCDs) for which tobacco is a
risk factor currently account for more than 55% of the mortality in the country and 50%
of the public-hospital admission (NACADA, 2012; Euromonitor, 2013).
As nicotine enters the body, it is distributed quickly through the bloodstream and crosses
the blood-brain barrier. On average it takes about seven seconds for the substance to
reach the brain when inhaled. Nicotine exerts its neurophysiologic action principally
through the brain's reward center by binding to nicotinic receptors. The nicotine
molecule increases dopamine levels in the reward circuits of the brain thus activating the
reward system and generating feelings of pleasure (Whirl-Carrillo et al., 2012).
2.1.2.3.1 Effects of nicotine
In general, nicotine has a psycho stimulatory effect on the CNS at low doses via
enhancing the actions of norepinephrine and dopamine in the brain. At higher doses,
nicotine enhances the effect of serotonin and opiate activity. It exerts a calming and
depressing effect (Manoranjan et aI., 2011; Garduno et aI., 2013; Koranda et al., 2013).
Nicotine-induced stimulation of the sympathetic nervous system causes palpitations,
increased blood pressure and coronary blood flow leading to cardiovascular diseases
(Chen et al., 2012; D'Alessandro et aI., 2012; Jones et aI., 2013). Smoking increases the
risk of respiratory, gastrointestinal, skin diseases and skeletal muscle tremors as well as a
29
number of tobacco-related cancers in addition to reproductive disorders (Al-Wadei et al.,
2012; Chakraborty et al., 2014; Harte; 2014; Merritt et al., 2013; Lavezzi et al., 2014).
Chronic nicotine use has been linked to tooth discoloration, tooth decay and gum diseases
(like gingivitis) and reduced appetite as nicotine mutes taste buds as well as depresses
appetite (Yann et al., 20]]; CDC, 2013a; Pilhatsch et al., 2014).
2.1.3 Cannabinoids
Cannabinoids refers to a group of substances that are structurally related to
tetrahydrocannabinol or that bind to cannabinoid receptors (NIDA, 2014). The principal
constituents of Cannabis are delta-9-tetrahydrocannabinol (D9-THC) and cannabidiol.
The former is the main psychoactive ingredient and it produces transient psychotic
symptoms as well as impaired memory in a dose-dependent manner. Cannabidiol does
not induce hallucinations or delusions but antagonises the cognitive impairment and
psychotogenic effects caused by D9- THC (Di Forti et al., 2009; Murray et aI., 2009).
Theoldest known written record on Cannabis use comes from the Chinese Emperor Shen
Nung in 2727 B.c. In 1545 Cannabis spread to the western hemisphere where Spaniards
imported it to Chile as fiber. In North America cannabis, in the form of hemp, was grown
onmany plantations for use in rope, clothing and paper (Gumbiner, 2011; DEA Museum,
2012). There are over 200 street names for marijuana including pot, herb, dope, reefer,
grass, weed, ganja, Mary Jane and chronic (NIDA 2013; Drugfree world, 2014). Over
the course of time, marijuana has evolved into four species, Cannabis sativa, C indica,
e. ruderalis and C. chinensis. C. sativa and C. indica are both found in Asia but
30
Cannabis sativa is the dominant variety in Africa (Craker and Gardner, 2010; Abel et al.,
2011). Cannabis sativa variety Linneaeus, (Plate 2.5) commonly known as marijuana
(with Tetrahydrocannabinol as the principle ingredient, figure 2.6) is a dioecious plant
(Craker and Gardner, 2010; EMCDDA, 2013d).
Figure 2.6: Chemical structure of tetrahydrocannabinol
Source: EMCDDA, 2013d
According to UNODC world report on drugs, Cannabis sativa l. remains the most widely
used illicit substance globally, with an estimated annual prevalence in 2010 of 2.6-5.0%
of the adult population (between 119 million and 224 million users aged 15-64 years).
There was a minor increase in the prevalence of cannabis users (180.6 million or 3.9% of
the population aged 15-64) as compared with previous estimates in 2009. The highest
prevalence of cannabis use being reported in Oceania (Australia and New Zealand) at
9.1- 14.6%, followed by North America (10.8%), Western and Central Europe (7.0 %)
and West and Central Africa (5.2-13.5%» while in Kenya 1.2% of the population use
marijuana (NACADA, 2012; UNODC, 20 13a).
31
Plate 2.5: Marijuana Plant (Cannabis sativa Linneaeus)
Source: Encyclopaedia Britannica Online
Globally, Cannabis sativa is distributed in five forms namely, bh~g (a paste of leaves of
the plant or dried leaves), ganja (dried flowering stem of the plant), charas (processed
from live buds), hashish (extracted from the resin covering the plant) and hash oil which
is thick oil that is obtained from hashish (National Cannabis Prevention and Information
Centre, 2012; NIDA, 2014). It can be smoked in cigarettes or in clay pipes (most
common method in religious settings and rural areas) and in water pipes like the
traditional hookah (UNODC and TISS, 2011).
Bhang consists of the dried seeded mixture of mature leaves and flowering shoots of both
female and male plants, wild or cultivated. It can be ingested orally (by adding to tea and
other beverages) or mixed with a combination of sugar, spices and fruit or smoked (alone
32
or mixed with cigarette). It is the weakest of all cannabis preparations and has a low
THe concentration (DEA Museum, 2012; Drugfree world, 2014; Narconon, 2014).
Ganja (Sinsemilla) consists of the dried unfertilized flowering tops of the cultivated
female cannabis plant, which become coated with a resinous exudation, chiefly from the
glandular hairs as consequence of being deprived of the opportunity of setting seed. As
the female plants begin to form flowers, all the large leaves on the stem and branches are
also removed. The smaller leaves and the bracts of inflorescence become agglutinated
into a mass called ganja (UNODC, 2014c).
Charas is processed from live Cannabis buds. Like ganja, it is smoked, but its THC
concentration is far higher. In comparison to bhang and ganja, charas is more potent as it
contains a relatively large amount of resin. Hash oil (also known as wax, nectar, full melt,
honey or budder) is a resinous matrix of cannabinoids obtained from the Cannabis plant
by solvent extraction which is formed into a hardened or viscous mass. Hash oil is more
potent than marijuana because of its high THC content although it varies depending on
the plant (Druglibrary, 2010; Hashish Centre, 2013).
Hashish is the most potent form of cannabis preparations being at least twice or as many
as strong as 10 times marijuana (Encyclopaedia Britannica, 2012). It is produced by
collecting and compressing trichomes (fine growths on cannabis plants that produce a
sticky resin). Hashish is consumed by heating it in a pipe, hookah, bong, bubbler,
vaporizer or hot knife (placed between the tips of two heated knife blades). It can be
33
smoked,mixed with cannabis buds or tobacco, cooked in foods or smoked as bottle tokes
(DEA Museum, 2012; Hashish Centre, 2013; Narconon, 2014; UNODC, 2014d).
Whenone inhales marijuana, THC is absorbed into the bloodstream and later the brain. It
then binds to and activates cannabinoid receptors which are activated by a
neurotransmitter called anandamide. Like THC, anandamide is a cannabinoid, but found
within the immune system of all animaJs, humans included. The THC then mimics the
actions of anandamide, meaning that THC binds with cannabinoid receptors and activates
neurons, which causes adverse effects on the mind and body. High concentrations of
cannabinoid receptors exist in the hippocampus, cerebellum and basal ganglia. The
hippocampus sits within the temporal lobe and is important for short-term memory.
When the THC binds with the cannabinoid receptors inside the hippocampus, it interferes
with the recollection of recent events. The THC also affects coordination, which the
t4
m cerebellum controls. The basal ganglia direct unconscious muscle movements, which is
Ianother reason why motor coordination is impaired when under the influence ofmarijuana (EMCDDA, 2008; Bonsor, 2011; NlDA, 2014).
2.1.3.1 Effects of Marijuana
Potential consequences include euphoria, slowed thinking and reaction time, risk of
developing psychiatric disorders, confusion, impaired balance and coordination., cough,
frequent respiratory infections, impaired memory and learning ability. It has also been
shown to cause increased heart rate, cardiovascular disease, anxiety, panic attacks, male
infertility, low birth weight infants, preterm birth, foetal growth restriction, increased risk
34
of infant mortality, tolerance and addiction (Sharma et al., 2012; Brown and Graves,
2013; Hall and Degenhardt, 2013; NIDA, 20t3; NIDA, 2014; Volkow, et al., 2014). In
addition, it impairs human reproductive potential by disrupting menstrual cycle,
suppressing oogenesis and impairing embryo development in women. In men it increases
ejaculation disorders, reduces sperm count and motility, it leads to loss of libido and
impotence (Bari et al., 20] 1; Amoako et al., 2013). High risk sexual behaviour, non-
adherence to ART and poly-drug use has also been reported among marijuana users
(Andrade et al., 2013; Mimiaga et al., 20 13).
2.1.4 Benzodiazepines
Benzodiazepines are sedative-hypnotics used to treat anxiety, insomnia, sleep disorders
andseizure disorders. Members of this class include Flunitrazepam (Rohypnol, illustrated
in Figure 2.7), alpranzolam (Xanax), bromazepam chlordiazepoxide (Librium) ,
lorazepam (Atavan) and diazepam like valium which are central nervous system
depressants. Some of the street names of Rohypnol include Date rape drug, La roche, R2,
Rib, Roach, Roofenol, Roofies, Rope, Rophies, Ruffles and The forget pill (CESAR,
2013). This study focused on recreational use of Rohypnol although medicinal use has
beenhighlighted.
35
F
_N
N~
I 0
H3C
Figure 2.7: Chemical Structure of Rohypnol (Flunitrazepam)
Source: Drug Bank, 2010
2.1.4 Rohypnol
Hoffman- La Roche, a Swiss pharmaceutical company was the first company to describe
and develop benzodiazepines in the 1950s. Roche modified the basic benzodiazepine
structure and introduced a munber of tranquilizers ]960s and ] 970s, including Rohypnol
in 1975 (Wick, 2013; Helmenstine, 2014). The medicinal use of flunitrazepam as a
hypnotic is intended to be for short-term treatment of chronic or .severe insomniacs not
responsive to other hypnotics (CESAR, 2013; Helmenstine, 2014).
Since the initial composition of Rohypnol tablets was odorless, tasteless, and dissolve
undetected in liquid, they were used to facilitate sexual assault. In the mid-I 990s, reports
surfaced that Rohypnol was being used in drug-facilitated sexual assault (DFSA) and it
became known as a date-rape drug. When mixed with alcohol, Rohypnol incapacitates
and induces amnesia, making one more vulnerable and unable to fight back or negotiate
with rapists. In addition one may be confused or unable to remember the rape when the
36
drugwears off. This delays reporting of the crime, hinders law enforcement response and
early medical intervention (Gemma and Fitzgerald, 2010).
In response to reports implicating Rohypnol in DFSA, the manufacturer reformulated the
tablets to oblong green tablets that have a dye which turns blue when dissolved in liquid
thus making the drug more easily detected in drinks (Badiye et al., 2012; DEA Museum,
2012; CESAR, 2013). The use of Rohypnol for recreational studies has been reported in
various studies both globally and locally (Brodish et al., 2011; Fulton et al.20] l ; Imer et
01.,2012; Kahuthia-Gathu et al., 2013; Lee et al., 2014).
Rohypnol binds nonspecific ally to benzodiazepine receptors BNZI (which mediates
sleep) and BNZ2, which affects muscle relaxation, anticonvulsant activity, motor
coordination, and memory. As benzodiazepine receptors are thought to be coupled to
garnma-aminobutyric acid-A (GABAA) receptors, this enhances the effects of GABA by
increasing GABA affinity for the GABA receptor. Binding of the inhibitory
neurotransmitter GABA to this site opens the chloride channel, resulting in a
hyperpolarized cell membrane that prevents further excitation of the cell (Drug Bank,
2010; EMCDDA, 2013).
2.1.4.1 Effects Robypnol
It has powerful hypnotic, sedative, anxiolytic and skeletal muscle relaxant properties. It
acts by depressing the CNS activity and brain function. This depressed CNS activity
manifests as sedation, sleep, muscle relaxation, reduced anxiety and blood pressure.
37
When mixed with alcohol, another CNS depressant, unconsciousness, stupor, respiratory
depression and death are more likely to occur. Overdose can cause drowsiness, memory
impairment, low blood pressure, dizziness, headaches, nightmares, confusion, tremors
and death (SAMHSA, 2010; Treweek et al., 2010).
Regular use of Rohypnol results in increased tolerance while sudden cessation leads to
withdrawal effects characterized by restlessness, anxiety, tremors, hallucinations, and
convulsions. One may also experience headaches, muscle pain, tension, numbness,
tingling of extremities, loss of identity, delirium and shock (SAMHSA, 20] 0; CESAR,
2013). Heroin users utilize Rohypnol to enhance the effects of low-quality heroin or to
relieve withdrawal symptoms. In contrast to cocaine users who take Rohypnol to soften
the negative effects of coming down from a binge (DEA, 2011; Roncero, 2013).
2.1.5 Alcohol
Alcohol (ethyl alcohol, ethanol or grain alcohol) is produced by the fermentation of yeast,
sugars, fruits and starches. Ethyl alcohol (Figure 2.8) is the intoxicating ingredient found
in alcoholic beverages like beer, wine and distilled spirits. Slang terms include booze,
bubbly, firewater, joy juice, sauce and liquid courage (NIDA, 2012; CESAR 2013).
38
Figure 2.8: Chemical structure of Ethyl AJcohol
Source: Pubchem
According to the World Health Organization (WHO), the harmful use of alcohol is a
global problem which compromises both individual and social development. It causes
harm far beyond the physical and psychological health of the drinker as it affects the
well-being and health of people around the drinker. Indeed it is a socio-medical problem
and results in 2.5 million deaths each year. An intoxicated person can harm others or put
them at risk of traffic accidents or violent behaviour, Of negatively affect co-workers,
relatives, friends or strangers. Thus, the impact of the harmful use of alcohol penetrates
deep into society (WHO, 2011a). The current use of alcohol among 15-65 year olds in
Kenya is estimated to be at 13.6% at national level and 10.6% in the coastal region
(NACADA,2012).
Ethanol appears to act by modifying cell membranes rather than by binding to specific
receptor sites on neurons like other compounds. Alcohol dissolves in the lipid layer of
39
cellular membranes' causing an increase in its fluidity. This change may modify the
actions of specific receptors or ion channels, resulting in the many behavioural effects of
ethanol. Gamma aminobutyric acid (GABA) and N-methyl-D-aspartate (NMDA) are
receptors that are associated with the effects of alcohol. The inhibitory effects of ethanol
may result from an enhancement of GABA receptor function, increasing the effects of
this inhibitory receptor which causes relaxation, relief from anxiety, ataxia and lowering
of inhibitions. A blockade of NMDA receptor function interferes with the effects of this
excitatory receptor. However, pinpointing a site of action of alcohol effects is difficult
because the drug affects virtually all neurochemical and endocrine systems (Drugfsank,
20]3; Adermark et al., 2014; Trudel et al., 2014).
2.1.5.1 Effects of Alcohol
When one consumes alcohol, it is absorbed in the stomach, enters the bloodstream and
goes to all the tissues. The effects of alcohol are dependent on a variety of factors like a
person's size, weight, age, and sex, as well as the amount of food and alcohol consumed
(Kokavec et aI., 2009; CESAR, 2013; Van Zanten et al., 2013). Effects of alcohol intake
include dizziness, confidence, slurred speech, disturbed sleep, nausea, vomiting, impaired
judgment and coordination as well as aggressiveness including domestic violence and
child abuse. It can also lead to reduced performance, hangovers (characterized by
headache, nausea, dizziness and fatigue) and accidents (Coskunpinar et al., 2013; Kask et
al, 2013; National Institute on Alcohol Abuse and Alcoholism-NJAAA, 2013).
Prolonged and heavy use of alcohol leads to alcoholism. It has been strongly linked to
systemic failure, malnutrition, cancer and suicide (Andrade and Gin, 2009; Canula et al.,
40
20ll; NACADA, 20]2). Mothers who drink alcohol during pregnancy may give birth to
infants with foetal alcohol syndrome who later may suffer from mental and physical
retardation (Ornoy and Ergaz 2010; Flak et al., 2013). Additionally, children of alcoholic
parents are at greater risk than other children of becoming alcoholics (Handley and
Chassin, 2013; Hussong et aI., 2012; NACADA, 2010).
Sudden cessation of long term, extensive alcohol intake is likely to produce withdrawal
symptoms like severe anxiety, tremors, hallucinations and convulsions (NlAAA, 2013).
In Kenya alcohol use and abuse is associated with domestic violence, marital separation,
child neglect, dropping out of school, loss of livelihood, idleness and crime (Githui,
2011; Birech et a/., 2013; Chweya and Auya, 2014). These factors are also determinants
of drug abuse and HlV epidemiological trends as discussed in the next sub-topic.
2.2 Socio-demographic Characteristics
Social and economic factors shape the risky behaviours and health of drug users. They
affect health indirectly by shaping individual drug-use behaviour and directly by
affecting the availability of resources, access to social welfare systems, marginalization
as well as adherence to medication. Drug-related activity has been associated with age,
familial dysfunction, reduced productivity, unemployment, poverty, drug-related violence
and gang activity (Peltzer et al., 2010; Van Wyk, 2011, Trenz et af., 2013).
Worldwide, most studies report the mean or median age of IDUs to be at about 30 years
(Cavlek et aI., 2011; Ulibarri et aI., 2011; Majidpour et al., 2012). These reports are
41
similar to findings of several studies in Africa (Needle et al., 2008; Parry et al., 2009;
Nsimba, et al., 2013) and Kenya (Brodish et al., 2011; Tun et al., 20] 1).
Young people are particularly at risk for psychoactive substance use, as they are at a
stage in life when patterns of behaviour are being formed. They are most likely to be
influenced by peers and role models who may be involved in the use of substances
(UNODC, 2011b; WHO, 2013h). That is partly why UNODC advocates for prevention
strategies that target working with families, schools, and communities. Such strategies
ensure that children and youth, especially the most marginalized and poor, grow and stay
healthy into adulthood (UNODC, 20 13b). Drug education if provided in school-based
and mass education programmes (like faith based institutions) has been found to reduce
riskof drug abuse (NACADA, 2012; Sabin and Ersin, 2014).
Lower educational level is an important predictor of one becoming an IDU. Low
educational level can be due to not enrolling in scbool at all, dropping out of school or
not progressing to higher levels. Dropping out from school is one of the social disruption
variables and a proxy indicator for initiation into drug use (Noroozi et al., 2012). Studies
have demonstrated that PWID with low level of education are more likely to share
needles and less likely to participate in my interventions in contrast to those with higher
educational attainment (Swe et al., 2010; CDC, 2012c, Gajendra et al., 2012; Medhi et al,
2012). This trend has been documented in Kenya, therefore the Kenya government's free
primary education and subsidized secondary should be supported by all as it aids in
keeping young people in school (Brodish et al., 2011; NACADA, 2012).
42
TheHlV prevalence among female IDUs (FIDUs) has been found to be higher than that
ofmale IDUs. This HIV gender disparity is replicated in the Kenyan general population.
For example, the 2012 Kenya AIDS Indicator Survey (KAlS) showed that although the
adult (persons between 15 to 64 years) HIV prevalence had dropped to 5.6%, a higher
proportion of women (6.9%) in the same age bracket were infected compared to their
male (4.4%) counterparts (NASCOP, 2013). In addition, a study carried out in Nairobi
show that females among the urban poor have remained more vulnerable to HIV-l
infection because they are more excluded from mainstream economic activities and thus
more affected by the ravages of poverty (Madise et al., 2012).
This gender variation could be attributed to social, cultural and biological factors. Social
factors that increase the risk of HIV infection include poverty, low levels of education,
intergeneration dating, early sexual 'debut and marital status. Moreover, most females
have limited negotiating power in terms of safer sex such as consistent condom use due
to male domination of sexual roles. Stereotyped gender relationships are a major barrier
for females in terms of maintaining safer sex practices with their partners (Amomkul et
01.,2009; Ulibarri et al., 2011 ;'Munyuwiny et aI., 2013; NASCOP, 2013).
Although this may be a problem for females in general, but for FIDUs it is even more
severe since they are marginalized by society. As a result the FIDUs often have strong
feelings of powerlessness, low levels of self-esteem and self-confidence. They also
experience impaired judgment while under the influence of drugs and extra sensitivity of
the genitals in females during heroin withdrawal episodes. In addition, many FIDUs
43
engage in precarious sexual and injecting practices. Moreover, many FIDUs have a
history of physical and sexual abuse (Ulibarri et al., 20]1; Moraros et al., 2012).
Globally studies and reports show that females who have been abused are more likely to
use drugs and have multiple sex partners (Moraros et 01., 2012; UNODC, 2012). The
same scenario has been documented in Africa (Ross et aI., 2008; McCurdy et al., 2010)
and Kenya as well (NASCOP, 2012a). On the other hand cultural practices like early
marriages, female genital mutilation, wife inheritance and wife sharing heighten the risk
ofHlV infection in women (Sesay, 2010; Kemboi eta!., 2011; Maleche and Day, 2011).
Women's biological susceptibility to HIV can be linked to large surface area of the body
parts like cervix, vagina and possibly the uterus where HIV transmission occurs in
women. As compared to men, small tears occur on the penis, foreskin and urethra. In
addition, HIV concentration is higher in semen than vaginal secretions and during sex a
significant amount of seminal fluid enters the woman's body. Furthermore, delicate tissue
of the genital tract can be damaged during intercourse, leading to increased abrasions and
vaginal bleeding, consequently increased risk of transmission. Moreover, the warmth and
moistness of the vagina provide HIV with an ideal place for micro-organisms to grow
(Stoecklein and Osuka; 2012; Ghosh et al., 2013).
Studies show that low levels of estrogen may increase a wornan's.risk for transmission of
my because it makes the vaginal wall thinner. Thinning occurs during menstruation and
menopause enabling HIV to penetrate more easily thus increasing vulnerability.
Furthermore, increase in progesterone level that occurs due to pregnancy or use of
44
progesterone based contraceptives has been linked to increased risk of Hl V acquisition.
On the other hand women under 24 may be at higher risk of mv infection because they
may have an immature cervix and genital tract. These are characterized by thinner cells
lining that tear more easily during sexual intercourse. This creates a conducive
environment for HIV to penetrate more easily into the vaginal wall of younger women
than in older ones. Furthermore, older women who have gone through menopause are at
increased risk of infection because their lining of their uterus is thinner and their vagina
drier (Carias et al., 2012; Stoecklein and Osuka, 2012; Grant et al., 2013).
Ingeneral, women are more prone to STls than men as symptoms of STls are often more
difficult to detect meaning STIs are not treated early enough. The presence of STIs like
candidiasis, herpes simplex virus 2 (HSV-2), bacterial vaginosis, chlamydia and the
human papilloma virus (HPV) increase the risk of HIV infection (Hilber et al., 2010;
Cohen et al., 20ll; Djoba, 2014). Vaginal practices like douching and vaginal structural
modification alters or destroys the friendly bacteria that protect the vagina. Douching is
the practice of washing the vagina before and after sex using water, soap, lemon juice,
antiseptics or other consumer douching products. Use of antiseptic or acidic liquids such
as rubbing alcohol or lemon juice can irritate the lining of the vagina and create
microscopic tears that HIV can pass through (Hilber et a/., 2011; Low et al., 20 II).
In SSA, vaginal practices are widespread with prevalence reportedly ranging from 6 to
98%. It has been reported in over 98 studies in 24 countries, many of which also focus
on traditional medicine to preserve health and wellbeing according to local health beliefs
45
(Redmond, 2011). In Kenya, vaginal washing using soap, acidic and or drying agents has
been reported among female sex workers. This has been shown to augment the odds of
HlV acquisition by almost three to four times (McClelland, 2008; Masese et al; 2012).
Familial dysfunction like separation and divorce as well as being single (never married)
predict a higher risk of Hl V infection among IDUs. These has been reported by several
studies in the USA (Heinz et al., 2009; Khan et al., 2012), Middle East (Majidpour et aI.,
2012), Africa (Drissa et aI., 2013; Kagaayi et aI., 2014) and Kenya (Tun et ai., 2014).
Moreover singlehood through separation, divorce or widowhood is associated with higher
rates of HlV infections in the general population (CDC, 20]2b).
ln the Kenyan general population, marital separation has been shown to increase the risk
ofHl V acquisition as reported in the KAlS report of 2012 (NASCOP, 2013). In addition
children from dysfunctional families are vulnerable to sexual abuse, delinquency and are
more likely to lack emotional security, trust as well as healthy parent-child relationship.
These factors increase vulnerability to homelessness, sex work and substance abuse
(Barth, 2009; UNODC, 2009; Massey et al., 20]4).
Furthermore, children of parents who are already drug users are likely to end up using
drugs. At the same time drug use affects parenting skills and such parents may end up
applying inappropriate disciplinary measures which may also trigger substance abuse
among the children (NACADA, 20] 0; NACADA, 20]2; Niccols et al., 20]2). To break
this vicious cycle of generational substance abuse, family skills training programmes that
46
aim at strengthening the famiJy protective factors need to be implemented at community
level (Niccols et al., 2012; Kumpfer, 2013; Tlale and Dreyer, 2013).
Homeless PWID as well as those in precarious housing conditions are likely to engage in
unhygienic injecting practices such as sharing injecting equipment and re-using cleaned
needles (Grebely and Dore 2011). At the same time they are more vulnerable to rape,
sexual assault and harassment (Mayhew et 01., 2009). In addition they are less likely to
bargain for safer sex and access primary health care. The homeless and marginally
housed HfV-positive IDUs are less likely to adherence to ARYs. Worldwide, the link
between hornelessness, injection drug use, undernutrition and HlY risk has been
extensively documented (Hendricks et al., 2010; Tang et 01., 2011; Cunningham, 2012;
Neaigus et al., 2013, Noor et al., 2013; Yogenthaler et al., 2013; Havinga et al, 2014).
In Kenya, the use of psychoactive substances among street children for survival and the
high HJY 'prevalence in this sub-population has been extensively documented in most
urban centres (Embleton et al., 2012; Embleton et al., 2013; Oino and Sorre, 2013; Oino
et aI., 2014). There is therefore need to incorporate interventions that promote family
relationships, family values and expectations in community based programmes.
Sex work IS associated with a host of psychosocial vulnerabilities like exposure to
childhood physical and sexual abuse, interpersonal violence in adulthood and substance
use which are risk factors for my infection. The relationship between sex work and drug
use is complex and inter-dependant. Drugs can be used to boost self confidence,
47
prolonged sexual performance as well as cope with the long and late working hours. On
the other hand drug users are likely to engage in transactional sex that is sex for drugs,
police protection or for money to purchase drugs. In addition substance use also helps
female sex workers (FSW) feel assertive while talking with men especially when
soliciting for clients (Ross et al., 2008; McCurdy et 01., 2010; Uuski.ila et 01., 2010;
Ulibarri et 01.,2011; Moraros et 01.,2012).
Female sex workers who inject drugs are also vulnerable to extortion either in cash or
kind from law enforcers and pimps. This causes them to engage more in high risk sexual
practices as they are more financially rewarding. Overall these multiple sexual
partnerships, sex with persons of unknown HIV status, sexual assault and rape is a good
recipe for Hl V acquisition or transmission. Additionally, drug-driven impaired judgment,
sex under duress and increased genital sensation during heroin withdrawal episodes
reduce their negotiation power for safer sex (Ross et 01., 2008; McCurdy et al., 2010;
Ulibarri et aI., 2011; NASCOP, 20l2a).
Overall sex work is associated with socio-demographic disadvantages like minority
ethnic status, low income, homelessness and low education level which are also
predictors of drug use as well as STIs including Hl V infection in both IDU and general
population (Swe et 01., 2010; Gajendra et 01., 2012; Noroozi et 01., 2012; Boden et 01.,
2013;Myers et al., 2013) These relationship is replicated in Africa (Kabbash et aI., 2012;
Ademolaer 01.,2014) and Kenya (Tegang et 01.,2010; Ngugi et 01.,2013).
48
The relationship between poverty and drug abuse is a complex phenomenon and is
affected by many contributing factors. Beyond the insufficiency of money, poverty
develops certain mindset, activities, behaviours and life conditions. These attitudes and
conditions can contribute toward drug usage. Poverty deprives the people from material
resources due to lack of sufficient income and as a result loose prestige and status in the
society(Niazi et aI., 2009; Farmer and Hanratty, 2011). Social inequalities induce social
exclusion, deprivation, marginalization and hopelessness which induce drug abuse. lllicit
drug use can be reduced by decreasing economic and social inequality as the prevalence
of drug use seems to be higher in countries with greater levels of inequality such as the
USA and lower in countries with less inequality such as Japan and the Scandinavian
countries (pickett and Wilkinson, 20] 0; Wilkinson and Pickett, 2010; Sutin et aI., 2013;
ThompsonJr et aI., 2013; UNODC, 2013b).
In Iran poverty, living in poor neighbourhoods or polluted suburbs and low level of
leisure facilities have been identified as predictors of drug use (Nadjme and Nouzar,
2014). In most African countries where poverty is widespread, youths roam the streets in
search of employment consequently some resort to begging as well as high risk sexual
behaviour and drug abuse (Fareo, 2012; Mbwambo et al., 2012). Similar scenario has
been reported in Kenya (Chesang, 2013; Korir, 2013).
2.3 Drug use patterns
2.3.1Mode of administration
A route of drug administration is a method in which a drug is taken into the body and
differs from the point at which the drug interacts and affects an individual. It is
49
determined primarily by the properties of the drug (for example, water or lipid solubility
and ionization) and therapeutic objectives like desirability of a rapid onset of action or
needfor long-term administration or restriction to a local site. Reasons for preferring one
route over another, depends on the desired effect (like speed and intensity), effect on
mood or behaviour, convenience, avoiding possible harms (for example infections and
overdose), need to protect the veins, avoiding injection marks or personal preference
(Harrella et al., 2012; Vorobjov et al., 2012).
Routes of drug administration can be categoried as topical, enteral and parenteral. Topical
administration entails direct application of the drug to the area that it is needed like
smokingand snorting. Enteral routes involve the digestive tract like orally taking the drug
or using a suppository. Parental routes make use of other internal pathways such as
subcutaneous, intravenous and intramuscular (FDA, 2009; Verma et al., 2010).
Smoking is one of the most common routes of drug administration. Whenever someone
smokes, the smoke goes to the lungs and is rapidly absorbed into the bloodstream. This
makes it one of the fastest ways for someone to experience euphoria as the chemicals are
transferred to' the necessary bodily receptors in five to ten seconds (NIDA, 2011; Surratt
et al., 201 1). On the other hand, during snorting about 30 to 60% of the snorted chemicals
enter the bloodstream through the mucus membrane in the nose. The rest is swallowed
andmoves down to the stomach where it finally reaches the bloodstream. The euphoria is
experienced within about 15 minutes (EMCDDA, 2010; EMCDDA, 2013t).
50
Oral ingestion allows the drug to move from the mouth to the stomach where it is
absorbed by the stomach lining and then enters the bloodstream. Swallowing is one of the
safest ways to take drugs as the substance is be slowly absorbed through the stomach
lining resulting in effects which are less extreme and therefore less dangerous. Secondly,
an individual's digestive system is designed to induce vomiting if that person ingests
anything risky (Verma et al., 2010; SAMHSA, 2012).
One of the riskier methods of drug intake is the use of suppositories where the substance
is absorbed through the mucus membrane in the rectum. Since the mucus membranes
around the rectum are very sensitive, the substance taken it can burn the lining causing
irreparable damage. Additionally, inserting anything into the anus can result in the lower
colon being perforated (Verma et aI., 2010; CESAR, 2013).
Parenteral route of administration is a recent development in the drug scene and involves
injecting of drugs directly into the blood stream. This can be either subcutaneous
(injecting into the soft tissue beneath the skin), intravenous (injecting into a vein) or
intramuscular which entails injecting into a muscle (FDA, 2009; Verma et aI., 2010).
Injecting route is more popular as the full effects are felt within 3 to 5 seconds. It also
bypasses many of the body's defenses and delivers the drug to the brain. That is why
injecting is more dangerous as substances which would have normally been rejected by
the stomach or blocked by the skin can easily enter into the bloodstream. Consequently,
increased chance of infection, scarring of the veins, arterial damage, hemorrhaging, distal
51
ischemia, gangrene, endarteritis, thrombosis and death due to overdose may occur
(Verma et aI., 20 J 0; Novak and Kral, 2011; Vorobjov et aI., 2011; Surratt et aI., 2{)1J).
Studies demonstrate that there is an increased chance of addiction for those who take
drugs via injections and smoking. This is because the heightened feelings that they
experience may lead them to come back and repeat the action simply to relive the
previous emotions. This may explain why tobacco smoking and injecting heroin are most
often associated with dependence among users. Cigarette smoking has been extensively
reported among PWID although the reason for this relationship is unclear (Marshall et
al., 20] l a; Harrell et al., 2012 Methoide, 2014).
2.3.2Mooosubstance versus polysubstaoce use
People who use drugs (PWUD) rarely limit their use to one substance and the
increasing prevalence of polysubstance use has been shown to contribute to the
already devastating HIV epidemic (Wechsberg et aI., 2008; Floyd et al., 2010).
The WHO defines polydrug abuse as the concurrent or sequential abuse of more than one
drugor type of drug, with dependence upon at least one and usually with the intention of
enhancing, potentiating, or counteracting the effects of another drug. The term is also
used more loosely to include the unconnected use of two or more drugs by the same
person(WHO, 2014b).
It occurs when an individual abuses several substances over a short period of time, often
inan attempt to enhance the effect of a single drug to create a more intense high. Other
52
individuals take a drug to counteract the effects of a drug they had taken previously like
taking sedatives to come off a stimulant effects. Some combination drug users have
patterned use like alcoholics who use cocaine only after they have reached a certain state
ofintoxication so as to avoid overuse and addicts who speed-ball (a mixture cocaine and
heroin)for intravenous use. Polydrug use can also be due to changes in price, availability,
legalityor fashion (EMCDDA, 2009).
Interactions between different drugs consumed close together in time can lead to
increased toxicity. This can occur due to additive or potentiation effects, pharmacokinetic
factors like reduced metabolism leading to higher blood concentrations of the drug or to
other interactions, such as the production of a new metabolite derived from the drugs or
products. The effects of certain psychoactive substances can also lead to increased risk
behaviourwith another substance (EMCDDA, 2009).
Theabuse of multiple substances continues to be a major public health concern in Europe
(EMCDDA, 2009; Irner et al., 2012), United States of America (Harrell et al., 2012;
Ogbu et al., 201.4), Latin America (Reyes et aI., 2012) and other countries in the world.
In Africa poly substance abuse is well documented in South Africa ((Floyd et aI., 2010;
Trenz et aI., 2013) and the Republic of Tanzania (Nsimba et aI., 2013). Although
literature on polydrug abuse is scanty in Kenya, the phenomenon bas recently been
reported 'among IDUs in Nairobi (Tun et al., 2014) and Malindi (Brodish et al., 2012),
53
Studiesshow that risky sexual behaviour in terms of a higher number of sexual partners
andhigher number of self-reported STls is influenced by the type of drug used as well as
route of administration (Celentano et 01., 2008; Vorobjov et 01., 2012). Poly substance
useincreases the likelihood of sexually transmitted HIV and other STIs (Mimiaga et
aI., 2008; Mayer et 01., 2012).
2.4Nutrition
Undernutrition is defined as insufficient provision of energy and nutrients, such as good
qualityprotein with an adequate balance of essential amino acids, vitamins and minerals,
andan inability to meet the requirements of the body to ensure growth, maintenance, and
specific functions (FAO, 2010; White el 01., 2012; WHES, 2012). Globally, between 842
and 870 million people or around one in eight people in the world are estimated to be
suffering from chronic hunger, regularly not getting enough food to conduct an active life
with Sub-Saharan Africa being the most affected region (WHES, 2012; FAO, 2014). It is
estimated that 42% of the people living in the horn of Africa are food insecure and
undernourished (FAO, 2010; USDA, 2012; USAID, 2014). In addition 50% of the
population of Nairobi (2 million people) is food-insecure. Similarly the Coastal region of
Kenya has been classified by Kenya Food Security Steering Group- KFSSG as a food
insecure (GOK, 2013).
In countries like Canada and India, reports show that between 30% and 70% of drug-
using individuals report some level of food insecurity and undernutrition (Anerna et al.,
2010; Tang et 01., 2011). Other studies show that, regardless of HIV status, nutritional
54
intakeof IDUs is well below the recommended dietary allowance for vitamins A, C, and
E, calcium and zinc in addition to low body mass index (Hendricks et al., 2009;
Hendricks et al., 2010; Karajibani et al., 2012; Strike et al., 20] 2).
Factors that influence nutritional status of a given population include food availability
(sufficient quantities of food available on a consistent basis), food accessibility (ability to
produce one's own food or buy it) and food use or quality which is the appropriate use of
food based on nutritional knowledge and care as well as adequate acess to water and
sanitation (Ajao et al., 2010; Kimani-Murage et al., 20]]; Saaka and Osman, 2013;
CIRAD,2014; WHO, 2014c).
Predictors of injection drug use; like poor educational attainment, homelessness or
unstable housing, unemployment or being on welfare or low income, lack of food
preparation and storage facilities, mental illness, high risk sexual and injecting behaviour,
social ostracization and frequent incarceration overlap with the determinants of food
security and nutritional status of any given population (Hendricks et al., 2009; Hendricks
et al., 2010; Brodish et al., 20] 1; Tang et al., 2011; Vogenthaler et al., 2013). In addition
these social predictors are associated with many negative social medical outcomes like
elevated risk of acquiring sexually transmitted infections and blood borne pathogens like
Hlv, Hepatitis Band C (Majidpour et al., 2012).
Undernutrition among mv -positive drug users exacerbates an already compromised
immune system (as the body lacks anti-oxidants which mop up harmful free radicals and
55
the nutrients needed to maintain immunity) and mitigates the effectiveness of
antiretrovirals, ultimately decreasing the survival chances (Van Gaalen and Wahl, 2009;
Hendricks,201O). In addition, undernutrition irrespective ofHIV status increases the risk
ofHIV transmission through sex and drug risk routes by compromising an individual's
immune-status as well as gut and genital mucosal integrity (Weiser et aI., 2008).
At the same time infections increase the risk of undernutrition because sick people eat
less, absorb fewer nutrients, lose nutrients (through diarrhoea and vomiting) and have
increasednutrient needs especially fever. In addition, infections weaken the linings of the
gut and respiratory systems making them weak and therefore can easily be invaded by
pathogens (Krawinkel, 2012; MacArthur and DuPont, 2012).
Infections like HIV may result in undernutrition as a result of insufficient dietary intake,
malabsorption and altered metabolism. Lack of sufficient food intake and/or
malabsorption leads to weight loss, which further exacerbates the hypercatabolic nature
ofmv infection and ultimately reduces the chances of survival (Koethe et al., 20] 0;
Andrade et al., 2012). People living with HIV/AIDS experience weight loss, loss of
muscle tissue and body fat, vitamin and mineral deficiencies. When the body mounts its
acute phase immune response to HlV infection, it releases pro-oxidant cytokines and
other oxygen-reactive species. These cytokines produce several results including
cachexia which is characterized by involuntary weight loss due to depletion of host
adipose ti~sue and skeletal muscle mass that is not associated with starvation (Braun and
Marks,2010;·Akiibinu et aI., 2012; Mody et al., 2014).
56
Inaddition it leads to anorexia resulting into lower food intake and fever which increases
energy expenditure. An augmentation in circulating inflammatory cytokines has been
implicated as a uniting pathogenic mechanism of cachexia and associated anorexia
Consequently this leads to reduced immune competence and increased susceptibility to
secondary infections (Braun and Marks, 2010; Shalini et aI., 2012; Mody et aI., 2014).
If the infection is prolonged, muscle wasting occurs because muscle tissue is broken
down to provide the amino acids with the immune protein and enzymes they need. These
processes increase energy requirements of people living with mY/AIDS during the
asymptomatic phase by 10 percent over the level of energy intake recommended for
healthy, non-HIV-infected people of the same age, sex and physical activity level
(Martins et al., 20 II; Sunguya et aI., 20] l).
AmongHrtls undernutrition is due to food insecurity, reduced food intake and food
malabsorption (NIH, 2012; Strike et aI., 2012; DRUG INFO, 2013). In the USA between
30 to 70% of drug using individuals report some level of food insecurity (Strike et aI.,
2012). Reduced food intake is attributed to hunger suppression, selective appetite,
distorted food taste and altered metabolic processes resulting in an imbalance between fat
intake and storage. This has been reported among people who chew khat, heroin and
cocaine users as well as tobacco smokers (Murray et aI., 2008; Douglas et al., 2011;
Mineur et al., 2011; Neale et al., 2012; Ersche et al., 2012b; Ersche et al., 2013;
Rubinstein andLow, 2013).
57
Overall drug addiction modifies eating habits, often causing individuals to adopt poor
dietary patterns such as an irregular eating schedule, eating fewer meals per week,
skipping meals or fasting to prolong the effects of drugs (Neale et aI., 2012). Poor
nutrient absorption is partly attributed to withdrawal symptoms like loss of appetite,
nausea, vomiting, diarrhoea nutrient maldigestion and direct nutrient loss (WHO 2009a;
Nel, 20]0; Smith et al., 2012).
Most IDUs face competing demands between addiction and subsistence, which in return
hinder access to groceries and food selection. As a result major components of IDU diets
have been reported as foods of low nutritive value which are mostly cheap and easy to
prepare foods, high-fat diets or ready to eat sweet and salty snacks while the minor
components are fruits, vegetables, grains and dairy products and hence undernutrition
(Hendricks et al., 2010; Alves et al., 2011; Saeland et al., 2011).
Under nutrition enhances susceptibility to infection in both Hl V infected and uninfected
persons with the former faring worse. Malnourishment is associated with an increased
risk of progression from latent to active TB because of the negative impact of micro and
macronutrient deficiencies on the cell-mediated immune system. Low BMI is a risk
factor for TB. In HlV mono infected patients a higher BMI is associated with better
survival outcomes and a lower BMI is a predictor of mortality (Knut et al., 2010; Maro et
01.,2010; Padmanesan et al., 2010; Semba et al., 2010).
58
It is important to note that under nutrition irrespective of the cause reduces CD4 and CD8
f-lymphocyte number leading to impaired cell-mediated immunity (CMJ) which is the
principle host defense against TB (Drake, 2010; Shalini et al., 2012). Both IDU and
HlYlAIDS are characterized with undernutrition which is a predictor of the health status
of a population and exacerbates progression from HlV to AIDS (Shannon et al., 2011;
Shaliniet al., 2012; Padmanesan et al, 2013).
Although information on food security and nutrition status of African as well as Kenyan
populations are well documented (FAa 2010; USDA, 2012; GOK, 2013; USAID 2014)
data on the same for the IDU subpopulation in this region is scanty. To the best
knowledge of the researcher there is no documented study on nutritional status and food
security of injection and non injection drug users in Africa as well as Kenya.
2.5 Tuberculosis
Tuberculosis is one of the world's deadliest diseases and it is estimated that one third of
the world's population is infected with TB. In 2013 alone, 9 million people around the
world had active TB and around 1.5 million TB-related deaths were reported 360 000 of
whom were HlY -positive. Tuberculosis is slowly declining each year and it is estimated
that 37 million liveswere saved between 2000 and 2013 through effective diagnosis and
treatment. Since most deaths from TB are preventable, the death toll from the disease is
still unacceptably high and efforts to combat it must be accelerated if the 20] 5 global
MDG targets are' to be met (CDC, 2014; WHO, 2014d).
N'l ITA U IVERS TY'=LI RA V;:
---.......... -
59
Kenya ranks thirteenth on the list of twenty two TB High Burden Countries (HBCs) in
theworld and has the fifth highest burden in Africa. These 22 HBCs account for 80% of
the global TB burden (WHO, 2013b). In 2013, Kenya observed a sharp decline of TB
cases, having a total number of 89,760 a 9.48% decline from the 99,159 cases observed
in 2012. Additionally, there was a reduction in the prevalence of TB among HIV sero-
positive patients from 44% in 2009 (WHO, 2009a; CDC, 2011a) to between 38.3% and
39%(MOH, 2012; MOH, 2013).
Globally it has been shown that both IDUs and non IDUs are at high risk of contracting
tuberculosis irrespective of their HIV status (Haileyesus et ai., 2013). Recreational drug
use is a risk factor for TB as a result of the overlap of epidemiological and social factors
associated with both drug use and TB (Deiss et aI., 2009; CDC, 2012d; Ruutel et aI.,
2012). Most IDUs are faced with undernutrition, poverty, homelessness and
overcrowding which are also risk factors for both HIV/AIDS and TB infections (Arema
et aI., 2010; Tang et aI., 2011; Strike et aI., 2012). Although the higher risk of TB
observed in IDUs is usually the result of associated HIV infection, the non IDUs are at a
higher risk attributable to the sharing of drug equipment such as marijuana water pipes,
smoking and living in cramped conditions or in dwellings with poor ventilation (Deiss et
aI., 2009; Getahun et al., 2012).
Furthermore, PLWHA who inject drugs have been found to be 85% more likely to have
Hlv-associated tuberculosis than those who were not injecting drug users. This higher
TB rates among PWID support evidence that IDUs are at higher risk of TB (Odendal,
60
2011; Baddeley, 2013). Since there are very few mono-substance users, polysubstance
use contributes to the already devastating HlV epidemic which in turn affects the
epidemiology of TB (Kalichman et al., 2006; Kedia et al., 2007; Wechsberg et al.,
2008;Floyd et al., 2010).
Furthermore drug use, HlV infections and undernutrition lower immunity thus increasing
the risk of reactivating Mycobacterium tuberculosis infection. Low body mass index
(BMI< 18.5 kg/m") and anaemia have been shown to predict high mortality among TB
patients. Moreover, patients with poor weight gains during TB treatment are at an
increased risk of treatment failure, relapse and premature death (Drake, 2010; Shalini et
al., 20]2; Mamani et al., 2013; McDennid et aI., 2013; Padmanesan et aI., 2013).
In South Africa, drug-related activity has been associated with poverty, reduced
productivity, unemployment, familial dysfunction, political instability, drug-related
violence, gang activity, escalating rates of blood-borne illness such as HlV/AIDS, TB
infections, injury, and premature death (Parry et al., 2009; Peltzer et al., 20]0; Van Wyk,
2011;Trenz et aI., 2013).
In Tanzania, mus have been shown to be at high risk for both TB and HIV with
outbreaks of drug-susceptible and multidrug resistant TB being reported in this sub
population (Gupta et al., 2014). At the time of this study, data on TB among IDUs in
Kenya was not available nevertheless drug use has been identified as a predictor of poor
adherenceto TB treatment in the general population (Muture et aI., 20] 1).
61
Since PLWHA are more likely to develop active TB in a given year than mv sero-
negativepersons due to their weakened immune system, TB screening is critical for the
IOU subpopulation (Hwang et al., 2009; USAID, 2013; WHO, 2013a). Recognizing the
important relationship between TB and drug use, the WHO, Joint United Nations
Programmeon mY/AIDS (UNAIDS) and the UNODC recently issued a set of guidelines
tobetter coordinate TB care among drug users (WHO, UNODC and UNAIDS, 2012).
2.6IDV
Despitethe global massive expansion of Hl V interventions, HlV burden remains a major
public health challenge. In 2013, 35.0 million people were living with HIV up from 29.8
million in 2001 due to continuing new infections, people living longer with HlV and
generalpopulation growth. In the same year, 1.5 million people died of AIDS which is a
35% decrease since 2005. This decline is partly due to antiretrovira1 treatment (ART)
scale-up(UNAIDS, 2014).
Sub-Saharan Africa, the hardest hit region is home to 71% of people living with HIV. In
2013 alone, there were 24.7 million people living with HIV in SSA with women
accounting for 58% of the total number of people infected. Swaziland has the highest
mv prevalence rate (27.4%) in the world. This high rate in SSA is fueled by poverty,
extensive sexual networks of men, cultural practices, unemployment, labour migration
and displacement as a result of conflicts (Fox, 2010; Coburn et al., 2013; Ramjee and
Daniels,2013; UNAIDS, 2014).
62
Although Kenya has one of the largest Hl V epidemics in the world, it is still widely
regarded as one of sub-Saharan Africa's success stories where mv prevention is
concerned. Annual new Hl V infections are roughly one third of what they were at the
peak of the country's epidemic in 1993. For example, in 2012 there were an estimated
100,000 new HlV infections in Kenya. Furthermore, during the same period the HlV
prevalence among adults aged 15 to 64 years decreased nationally from 7.2% as
measured in KAlS 2007 to 5.6%. At the same time, the distribution of HlV infections
varied across the country with Mombasa region reporting an Hl V prevalence of 4.3%
from7.1% in 2007 (NACC and NASCOP, 2012; UNAIDS, 2013; NASCOP, 2014).
2.6.1 HIV and Injection Drug Use
Inthe context of Hl V epidemiology, people who inject drugs are classified as the most at
risk populations (MARPs). Their vulnerability is attributed to precarious injecting
practices, high risk sexual activities, under utilizatition of health services and poor
adherence to treatment (Uuskula et al., 2010; Cavlek et al., 2011; Muture et al., 2011;
Ulibarri et al., 2011; CDC, 20 12d; Orsetti et al., 2013; WHO, 2013a).
Sharing mainly occurs because the needles and syringes are either not enough, available,
accessible or affordable to IDUs. The accessibility of new needles and or syringes is
hindered by various structural factors like refusal by pharmacy operators to sell needles
or syringes to IDUs. Furthermore, geographic locations (like distance between shooting
galleries and pharmacies), perceptions about stigma and concerns about confidentiality
hinders accessibity. Sometimes sharing occurs due to drug impaired judgment or as a sign
63
ofbrotherhood (Chakrapani et al., 2011). In addition, when heroin is scarce or resources
are limited, some IDUs seek partnerships with others to enhance their ability to raise
funds to purchase drugs and such efforts often lead to group injection (Mateu-Gelabert et
al., 2010).
High risk sexual activities among PWID include multiple sex partnerships, having
unprotected sex with partners of unknown HIY status and engaging in sex for drugs or
for money to purchase drugs as well as survival. Besides, sex for police protection, group
sex, anal sex, sexual assaIt, unconsented sex and partner sexual violence have been
reported in this population (Mayhew et al., 2009; Swe et al., 2010). The higher
prevalence of HIY among women than men, together with a lower prevalence of HCY
provides evidence of sexual transmission of HIY among IDUs. This is of considerable
concern given that SSA has the world's largest population of individuals living with my
(Bowring et aI., 2012; UNAIDS, 2012).
In Africa unsafe sexual and injecting practices among IDUs are welJ documented. For
example in South Africa, drug use has been linked to increased risk of HIY acquisition
and transmission with IDUs being more at risk than the non- IDUs. In Egypt, high risk
behaviours like multiple partnerships with men who have sex with men, female sex
workers and other regular or casual partners has been reported (Soliman et al., 2010).
Closer home, Tanzania has been identified as one of the sub-Saharan African countries
experiencing significant changes in the patterns of illicit drug use. These include both
64
non-injecting and injecting drug use in addition to increasing prevalence of unsafe
injection and sexual practices. For example blood flashing and sharing, sex for drugs as
well as sexual multiple partnerships has been reported among PWID in Tanzania
(McCurdy et 01.,2010; Atkinson et 01., 2011; Bowring et al., 2012).
High risk injection practices have been documented among Kenyan IDUs. These
practices include syringe and needle sharing, using pre-filled needles and syringes, front
orback loading, sharing of preparation water, sharing equipment and drawing drugs from
a common container (Brodish et al., 2011; NASCOP, 2012a; TlID et al., 2014).
Precarious sexual tendencies like multiple sexual partnerships with persons of unknown
HlV status have been reported. These include rape, sexual assault, unprotected sex which
couldbe consented or unconsented due to drug impairment, sex for police protection, sex
for drugs and sex for money to buy drugs as well as survival (Tegang et 01., 2010;
Brodish et 01.,2011; NACADA, 2012; Kahuthia-Gathu et 01.,2013; NASCOP, 2013).
2.6.2HIV Subtypes: Global Outlook
There are two types ofHIV which have been distinguished genetically and antigenically.
The Hlv-I sub-type is the cause of the worldwide pandemic while mV-2 is
predominantly found in West Africa. The HIV-2, which is transmitted in the same ways
as HlV-1 is less lethal than HIV -1 but otherwise clinically the diseases are very similar.
HIV-I and HIV-2 are thought to have arisen from two natural hosts both harboring
Simian Immunodeficiency Virus (SlY). The closest relative of HIV-I is SIVcp2 which
infects wild-living chimpanzees (Pan troglodytes troglodytes) and gorillas (Gorilla
65
gorilla gorilla) in west central Africa while HIV-2 is SIVsrnm harbored by sooty
mangabeys,Cercocebus atys (Sharp and Hahn, 2010; Sharp and Hahn, 2011).
Thereare three sub-groups ofHIV-I, M (main or major), N (new) and a (outlier). Type
o IDV-I is mostly found in Cameroon and Gabon while the rare N sub-group is found in
Cameroon. It is very likely that SIVcpz infected humans on separate occasions to give
rise to the three sub-groups. In addition, there are at least ten different HIV-I subtypes
withinthe M group and they are designated A to K (Hunt, 2010; Sharp and Hahn, 2011;
Kerinaet aI., 2013).
Most sub-types are found in sub-Saharan Africa with A and D dominating Central and
Eastern Africa and C in Southern Africa (lung et aI., 2012; Kiwelu et aI., 2012). This
subtypeC is also predominant in India and Nepal. It is also the cause of most infections
worldwide and is linked to mother to child HIV transmission (Zhanga et aI., 2009; Shen
et al., 2011; Alcantara. et al., 2012). Sub type B is majorly in North America, Latin
America, the Caribbean, Europe, Japan and Australia (lunqueira et aI., 2011; Abecasis et
a/., 2013; Mendoza etal., 2014). Type E has been isolated in Thailand and central Africa
while type F is predominant in Brazil and Romania. On the other hand, type G has been
reported in Russia and Gabon while type H is found in Zaire and in Cameroon (Alcantara
et aI., 2012; Fayemiwo et aI., 2014). Subtype K has been isolated in the Congo and
Cameroon (Sharp and Hahn, 2011). Although subtype I was a name given to an apparent
sub-type found in Cyprus but the name is no longer used since it is now classified as a
recombinant (Hunt, 2010; Kousiappa et aI., 2011).
66
In some countries, mosaics (recombinants) between different subtypes have been found.
These arise when two different subtypes infect a person at the same time and
recombination occurs. For example, the former subtype I is a circulating recombinant
form (or CRF) that is a recombinant of subtypes A, G, H and K. In addition, the
polymerase genes of HIV -1 strains from Ghana are made up of recombinants of several
CRF 02-AG strains from Ghana, Senegal and Cameroon (Sagoe et al., 2009; Kerina et
al., 2013; Palm et al., 2013).
Based on laboratory studies, different HIV -1 subtypes can be transmitted by different
routes. For example, type B may be transmitted more effectively by homosexual
intercourse and via blood (as in injection drug use) whereas types C and E may be
transmitted more via a heterosexual route. This is because types C and E replicate better
in Langerhans' cells found in the mucosa of the cervix, vagina and penis while type B
replicates better in the rectal mucosa. It also appears that type E is more readily
transmitted between sexual partners than type B (Haaland et al., 2009; Almeida et al.,
20]2; King et al., 2Q13). Subtype D appears to be more virulent than subtype A. In
addition subtypes D and C seem to be transmitted more effectively from mother to child
than subtype A (Krivine et al., 2009; Hunt, 2010; Ryland et al., 20J 0; Zhang et al.,
2010).
2.6.3 HIV Subtypes in Kenya
InKenya, HIV -1 subtype A has been reported as the dominant strain in southern part of
the country with over 30% recombinants while subtype C is more predominant in
67
northernpart. Subtypes A, B, C, D and G together with their recombinants have also been
descnbed in various parts of the country. Irrespective of the region, subtype A remains
theprincipal strain but there is an increase in the prevalence of subtype C (Khamadi et
al., 2009; Lihana et aI., 2009; Kageha et aI., 2012; Lihana et aI., 2012; Muriuki, 2012;
Kiptoo et aI., 2013; Nyamache et al., 2013; Bezemer et aI., 2014). Kenya appears to
havean array of subtypes that co-circulate courtesy of increased human migration in and
aroundEast and Central Africa (Hue et a/., 2012; Lihana et al., 2012).
2.6.4HIV Subtypes in the IDU population
Due to both high risk sexual and injecting practices, IDUs are likely to have diversified
illV types and recombinants. Globally the explosive outbreak of Hl v-I circulating
recombinant forms among IDUs has been extensively documented for example in
Afghanistan, China, Greece, India and Taiwan (Sanders-Buell et al., 2010; Yen-lu et aI.,
2010;Sarkar et al., 2011; Paraskevis et al., 20] l ; Han et aI., 2013).
In Kenya investigation on the molecular epidemiology of different HIV-I subtypes and
their associated risk factors among IDUs is limited. Despite this constraint, Osman et at.
(2013) has reported subtypes AI, B and C to be circulating among IDUs in Mombasa.
Mombasa which is a coastal cosmopolitan city has the largest number ofMARPS. These
include PWIDs, men who have sex with men (MSM) and sex workers (NASCOP,
2012a). Due to their high risk injecting and sexual behaviour the probability of HIV co-
infections as well as super infections is high. This key sub-population does not operate in
68
exclusionbut instead acts as a bridge to the general population thus fueling HlV
epidemicsin the region.
2.7Drugs and Immunity
Previous and ongoing studies as well as reports indicate that drug use diminishes
immunity. For example, use of opiates (like heroin and opium) affects several
components of the immune system and thus modulates host immunity increasing
susceptibility to infections (Ramsin et al., 2008; Haghpanah et al., 2010). In addition,
nicotineuse has been shown to suppress the immune system there by increasing the risk
of infection and poor disease prognosis (Comer et aI., 2014; Padmanesan et al., 2013;
Van Zyl-Smit et al., 2014). Furthermore, cathinone and cathine reduces post-translational
modifications of intracellular signal transducers in T-lymphocytes, B-Iymphocytes,
naturalkiller cells and monocytes leading to impaired immunity (Bredholt, 2013).
Weakened immunity can be as a direct result of using drugs or indirectly due to binging
which causes the user to be ill and dehydrated. The impact of dehydration, mental and
physical exhaustion, sleeplessness and lack of food depletes the immune system (Molina
et 01.,2010). Diminished immune system in addition to sharing of drug equipment such
as marijuana water pipes, smoking as well as living in poorly ventilated dweIIings
increases the risk of acquiring tuberculosis (Deiss et al., 2009; Getahun et aI., 2012).
Beside PWID are less likely to access healthcare facilities as well as adhere to long term
TBand HlV therapy (Dutta et al., 2013; Singer, 2014). Therefore, drug use, exposure to
HIV and TBas well. as undernutrition combined or separately leads to reduced immunity
69
and thus inability to resist or withstand infections. By and large drug use reduces quality
oflife and productivity in addition to increased risk of contracting infections as well as
prematuredeath. Moreover, drug users are more likely to develop mental disorders even
after rehabilitation. Consequently, recreational drug use should be dealt with as a socio-
medicalproblem and not a criminal offence.
2.8Other Common Co-morbidities
2.8.1Hepatitis Band C
2.8.1.1Hepatitis B
The term hepatitis simply means inflammation of the liver and humans are the only
reservoir of hepatitis B virus (HBV). The virus is transmitted by percutaneous and
pennucosal exposure to infected blood and other body fluids, mainly semen and vaginal
fluid.This can happen through sexual contact with an infected person or sharing needles,
syringes, or other drug-injection equipment. Hepatitis B can also be passed from an
infectedmother to her baby at birth (WHO, 20Bc; Hoffmann et al., 2014; Moezzi et aI.,
2014; Ramezani .et al., 20]4). Hepatitis B can be prevented via vaccination which is 95%
effectivein preventing infection (CDC, 2013d; WHO, 20I3d).
2.8.1.2Hepatitis C
Hepatitis C is a liver disease caused by the hepatitis C virus (HCV). The HCV is most
commonly transmitted through exposure to infectious blood. This can occur through:
receipt of contaminated blood transfusions, blood products, organ transplants, injections
given with contaminated' syringes and needle-stick injuries in health-care settings,
70
recreational injection drug use, beauty treatments and being born to a hepatitis C-infected
mother(CDC, 20Bc; Villar et al., 2013; WHO, 20Be; Ramezani et al., 2014).
Thereis no vaccine for Hepatitis C but can be prevented by avoiding behaviours that can
spread the disease, especially sharing drug needles or personal items such as
toothbrushes, razors, and nail clippers with an infected person· (CDC 2012c; Hepatitis
Foundation international, 2013; WHO, 20 Be).
2.8.2Tetanus
Tetanusis an acute illness caused by the toxin of Clostridium tetani. Soil, street dust and
intestinal content of animals and humans are the normal habitat of the organism, but
contamination of any wound can result in tetanus. Tetanus among PWID has been
reported worldwide (CDC, 2011). Drug injection provides several potential sources for
infectionwith C. tetani, including the drug itself, its adulterants like contaminated heroin,
injection equipment and unwashed skin. Although recommendations to prevent
transmission of HIV among IDUs may limit infection from contaminated injection
equipment, these measures may not be effective against spores inoculated from the skin
or contained in the drug (WHO, 2009a; Health Protection Agency, 20 II). So far, there is
nocure for tetanus but it can be prevented by the administration of tetanus toxoid (WHO,
2009a;CDC, 2013e, WHO, 20BfWHO, 2013g).
2.8.3Dermatological disorders
Skin and soft tissue bacterial infections are a common complication of IDU due to
injection of drugs into the fatty layer under the skin. Additionally, leakage of drugs out of
71
veinsduring injection (extravasation) and necrosis as a result of toxic materials in drugs
as well as increased numbers of bacteria on the skin surface lead to dermatological
disorders. Continued use of intravenous drugs can damage both the skin at the site of
injection as well as internal organs. A case in point is recurrent suppurative skin
infections as a result of subcutaneous administration of drugs being associated with
AmyloidA amyloidosis which leads to progressive loss of renal function (WHO, 2009a;
Tomlinson,2010; Nayer, 2014).
Although skin infections usually present as areas of redness, warmth and tenderness
(inflammation), the appearance in IDUs is often atypical. Infections usually affect the
armsor legs as these are the sites used most frequently for injection. Unusual sites may
be involved like the abdomen, back, groin, scrotum and neck due to injecting in the
jugular or femoral veins. A more recent study carried out in Glasgow, United Kingdom
reported a high prevalence (60%) of skin disease and surprisingly high rates of leg
ulceration (15%) among PWID (WHO, 2009a; EMCDDA, 2011b; Coull et al., 2014).
2.9 Prevention and Management of drug use and addiction
It is time for drug abuse to be seen as public health problem aed not a criminal problem.
The consequences of drug abuse and addiction are costly in terms of preventable health
care, law enforcement and crime among other costs. In Kenya, it has been note that drug
treatment reduces likelihood of HIV infection by 6 fold in injecting drug users at the
same time presents opportunities for screening, counseling, and referral (NACADA,
2012). According to UNODC, for every dollar spent on prevention, at least ten can be
72
savedin future health, social and crime costs (UNODC, 2013b). The best approach to
reducingthe tremendous toll from substance abuse is to prevent the damage before it
occurs.These strategies include demand reduction, supply reduction and harm reduction.
2.9.1 Demand reduction
Reducingdemand consists of creating an environment where the vast majority of people
whohave never taken drugs continue to resist any pressures to do so, and making it easier
forthose that do to stop. Drug and substance abuse prevention intervention programmes
shouldtarget risk factors and enhancing protective factors at all levels therefore reducing
demand for drugs. Moderators that need to be promoted in order to prevent drug use
include but are not limited to substance and drug abuse awareness, improvement of
school enrollment and retention rate, drug resistance skills, personal self-management
skills,general social skills, positive peer pressure, good parenting skills, strengthening of
the family fabric, poverty eradication and wealth creation as demonstrated in Srikala and
Kishore (2010), Mahmoudi and Moshayedi (2012), Niccols et al. (20]2), Crowley et al.
(20]4) and Massey et al, (2014).
2.9.2 Supply reduction
The basic goals of supply reduction and drug law enforcement agencies are to minimize
the supply of drugs to illicit markets and to increase the price and inconveniences of
acquiring drugs. A fundamental aspect of the drug market is that supply responds to
demand and vise versa in accordance with basic economic theory. By targeting to reduce
production, distribution, and sales of drug at street level, distributing and selling illicit
73
drugwill be more risky and shortage of drug will increase the price to drug users. In
addition,this strategy should be directed towards regulating and enforcing access to legal
drugsand substances, particularly those that are of a high probability for abuse, including
pharmaceuticals and other precursors and essential chemicals (UNODC and TISS, 20]];
Werbet al., 201]; Sabin and Matusitz, 2012; Werb et al., 20]3; Sahin and Ersin, 2014).
2.9.3 Harm reduction
Harm reduction refers to approaches to psychoactive drug use that aim to reduce the
harmsassociated with drug use for people who are unable or unwilling to abstain. The
prevention of harm is given the highest priority rather than achieving indefinite
abstinence from illicit drug use regardless of the unintended negative consequences. Its
approach to drugs is based on a strong commitment to public health and human rights
(International Harm Reduction Association- IHRA, 2010; UNODC and TISS. 2011).
Comprehensive harm- reduction services benefits people who use drugs, their families
andthe community as is associated with reversal of a rapidly emerging epidemic of HIV
amongPWID (Sharrnin, 20]3; Huang et al., 2014).
The concept of harm reduction and minimization for drug users was born in 1986 with
the realization that the Hl V virus was being spread through the sharing of syringes
amongst heroin injecting users. To reduce the risk of an increase in AIDS cases, Australia
took the bold step and led the world into implementing the availability and distribution of
new syringes to IDUs. As a result, Australia has the lowest incidence of HIV amongst
74
injecting drug users in the world, less than 2% compared to figures up to 90% in some
othercountries (Commonwealth of Australia, 2011).
Theharm-reduction approach applies various strategies which include but are not limited
to addiction counseling, STIs treatment and HIV testing including linkage, educational
interventions, needle syringe exchange programmes, detoxification, oral substitution
therapy-OST (like methadone and buprenorphine treatment) and Supervised Injecting
Facilities [SlFs].
Research indicates that majority of PWUD have an underlying mental health condition,
significant emotional or psychological difficulty and thus require both addiction and
general counseling (Munro and Allan, 2011; UNODC and TISS, 2011; NIDA, 20l2). A
goodcounseling programme incorporates family therapy as drug addiction does not only
affect the. user's life but the whole family (Centre for Addiction and Mental Health -
CAMH, 2010). Studies show family therapy results in lower relapse rates, increased
happiness in the family and better functioning in children of addicted parents (Munro and
.Allan,2011; UNODC and TISS, 2011; Evans et aI., 20]2).
Screening of STIs and respective treatment in addition to HlV testing and linkage is an
important aspect of harm reduction as some STIs cause open wounds or ulcers to form in
the genital area. These openings provide a way for HIV to enter the blood stream.
Although some STIs don't cause open wounds but the presence of the STI causes the
body to increase the concentration of CD4 cells in the genital area which provide HIV
with a favourable target for infection. In addition, people infected with STIs have
75
increasedconcentrations of HIV in their genital fluids, increasing the possibility of HIV
transmission(CDC, 2010; Cohen et 01., 20]2; Zhang et 01., 2013a). It is imperative to
preventand manage STIs including HIV infections in this sub-population as most PWID
tendto engage in precarious sexual practices,
Peereducation is a strategy whereby individuals from a target group provide information
or training to their peers. These groups can be determined by socio-demographic
characteristics (like age, education, type of work) or by risk-taking behaviour (like
injection drug use, sex work and sexual orientation). Peer networks increase the
credibility and effectiveness of the message being presented (Research to Prevention,
2010; UNODC, 2011b; Jain et 0/., 2014).
Syringe and needle exchange programmes (SNEP) exemplify harm reduction because
theyreduce the harms from drug use to drug users, their families and community without
requiring a change in the consumption of drugs. These programmes work on the
philosophy of providing sterile and new needles and syringes to mus in exchange of old
usedand potentially infected ones. The exchange component has multiple benefits as it
ensures that all the used injecting equipments have been collected from the mus and
destroyed under supervision, minimizing the risk of reuse and accidental exposure.
Secondly, it provides an opportunity for frequent contact with mus, during which not
just needles and syringes but education and other services can be delivered (Global
Commission on Drug Policies, 2011; UNODC and T1SS, 2011). Furthermore, SNEP
76
encouragethe entry of PWID into drug detoxification and treatment programmes
(Alkiviadiset al., 2010; O'Gurek and Kirchner, 2010; Aspinall et al., 2014).
Detoxificationservices can help to ensure that withdrawal is safe and comfortable and
warndrug users of the risk of an overdose on relapse. It is a prelude to treatment and not
distincta form of treatment (Global Commission on Drug Policy, 2011; Katz et al., 2011;
Chandraand Madison, 2012; NIDA, 2012).
Methadoneand buprenorphine treatment have been endorsed by the WHO and UNAIDS
asopioid substitution treatment (OST) for heroin dependence (WHO, 2009b; UNAlDS,
20].1; UNODC, 2013c; Wu and Clark, 2013). Both epitomize harm reduction because
theyreduce the harms ·of street heroin use without requiring the drug user to abstain from
theuse of mood altering drugs. The effectiveness of OST in treating opiate addiction,
reducingdrug use, reducing the frequency of sharing potentially HIV-contarninated
.syringesand needles, and preventing HfV infection has been well documented. Strong
evidence indicates that appropriate doses of methadone or buprenorphine relieve
cravings,block the effect of illicit opioids and prevent withdrawal. Reduce frequency of
injectingdrugs, reuse of syringes and needles has also been reported (Kimber et aI.,
2010; ECDC, 2011; MacArthur et al., 2012; Wang et al., 2014).
Researchinto treatments for stimulant (like amphetamine and cocaine) addicts lags far
behindas compared to treatments for heroin dependence. Dexamphetamine substitute
treatmentfor amphetamine dependence shows promise and appears to be effective and
77
safe. Use of dextroamphetamine has been associated with higher rates of sustained
amphetamineand cocaine abstinence (Castells et 01.,2010; Galloway et 01.,2011).
Supervised Injecting Facilities also known as Supervised Injection Sites (SIS), Safe
Injection Site, Safer Injection Facility (SIF), Drug Consumption Facility (DCF), Drug
Consumptionrooms (DCR) or Medically Supervised, Injection Center (MSIC) are legally
sanctioned and medically supervised facilities where injection drug users are allowed to
injectpre-obtained drugs in a more protected, hygienic and less stressful environment
comparedwith most other private and public settings. The first injection room appeared
inBern, Switzerland, in 1986. In the decade that followed, SIFs spread to other cities in
Switzerland as well as cities in Germany and the Netherlands. Since 2000, SIFs have
been introduced in Spain (Madrid and Barcelona), Australia (Sydney) and Canada
(Vancouver). These facilities are exempted from the application of the criminal code or
otherlegislation that governs the use of controlled substances (Csete, 2010; Davies, 20 10;
Hedrichet 01.,2010; UNODC, 2012).
Theiraim is to establish contact with hard-to-reach populations of drug users, provide an
environment for more hygienic drug use, reduce morbidity and mortality risks associated
with drug use. (in particular street-based drug injecting), lessen overdose episodes and
promote drug users' access to other social, health and drug treatment services (Salmon et
al.,2010; Marshall et 01.,2011 b; De Vel-Palumbo et 01.,2013; EMCDDA, 2013g).
78
It is imperative to note that promoting harm minimization does not condone illicit drug
use.It acknowledges that many people are not able to give up drug use without help. It is
a means of reducing the risk of harm to a person so that they are kept alive and if they
eventually decide to stop their drug use, they will not suffer serious consequences from
theirdrug use (DeBeck et 01.,20] 1). Despite good evidence for its effectiveness in HfV
prevention, several countries remain resistant to harm reduction (Rhodes et 01.,2010).
2.9.4 Rehabilitation
TheWHO defines rehabilitation as the process by which an individual with a substance
use disorder achieves an optimal state of health, psychological functioning, and social
well-being. The general intent is to enable the patient to cease substance abuse, in order
toavoid the psychological, legal, financial, social, and physical consequences that can be
caused, especially by extreme abuse. Drug users have a right to voluntary rehabilitation.
After rehabilitation they are expected to be socially reintegrated into the wider
community (Gifford, 2014; Reif et 01.,2014; WHO, 2014b).
2.10Challenges
Globally, harm reduction strategies addressing drug issues are so unpopular amongst
politicians, policemen, magistrates and bureaucrats. In many countries publicly
supporting an innovative harm reduction strategy like SIF is considered political suicide.
Tbe Global Commission on Drug Policy has been urging politicians to courageously
speakout on effective drug policies (Global Commission on Drug Policy, 2011).
79
Thesituation is not better in Kenya as most decision makers like politicians (primarily
lawmakers), police (law enforcement officers), magistrates and judges (criminal justice
authorities),technocrats, bureaucrats and religious leaders are not willing to support harm
reduction strategies in letter and spirit. The criminalization of drug use promotes
arbitraryarrests of PWID which it leads congestion in prisons which in return facilitates
druguse among inmates, some who are first time users (Kinyanjui and Atwoli, 2013).
Peoplewho inject drugs are likely not to optimally adhere to long term treatment. This
hasbeen attributed to delayed access to health facilities, competing comorbid diseases,
stigma, discrimination, poverty, criminalization of drug use and poorer long-term
adherence(Cayla et al., 2009; Muture et al., 2011; DeSilva et al., 2013). In addition, the
potentialinteractions between methadone and buprenorphine with substances of abuse as
wellas medicinal drugs like Nevirapine, efavirevz, and Rifampicin reduce the efficacy of
OST (Lee et al., 2012; McCance-Katz et al., 20] 3; Vilas-Boas et al., 2013).
Besides, in Kenya there are limited government funded rehabilitation centres and most
clients seeking rehabilitative services end up being held in lID suitable venues like the
medical or psychiatric wards. Besides most government funded rehabilitation centres do
not admit FIDUs. Moreover, MAT is mostly available in privately owned facilities.
2.11 Conclusion
Since drug and substance abuse is a socio-medical problem, public health interventions
aimed at improving the health of drug users must address the social factors that
80
accompany and exacerbate the health consequences of illicit drug use. People who use
drugshave the same human rights as people who have never used drugs. These rights
includethe right to the highest attainable standard of health, to social services, to work, to
benefit from scientific progress, to freedom from arbitrary detention and freedom from
cruelinhuman as well as degrading treatment.
81
CHAPTER THREE: MATERIALS AND METHODS
3.1 Study Design
This study was carried out in Mombasa County with an objective of determining the
predictors of HIV and puJrnonary TB among PWID. It was a cross sectional study which
focused on assessing a representative subpopulation of PWID at one specific point in
time.Disease and exposure status were measured simultaneously. This study design has
been used for similar studies like in Cavlek et al. (2011), Majidpour et al. (2012) and
Karajibani et at. (2012).
3.2 Variables
The independent variables (risk factors) were high risk injecting and sexual practices,
mono or polysubstance use and exposure to ST1s while the dependent variables HIV
infection, low BM1, Jaw CD4 count, TB and HIV sub-types.
3.3 Target and Study Population
The target population was a community living in a cosmopolitan coastal city while the
study population was PWID living in Mombasa County, Kenya.
3.4 Study Site.
The study was carried out in purposively Mombasa County based on the fact that it bas
the largest number of PWID in Kenya. Mombasa acts as a conduit of drugs from South
America en route to Europe and Asia and in the process some of the drugs find their way
82
into the local market. The IDU participants were recruited from Bomu Hospital as it has
supportgroups for recreational drug users as well as PLWHA.
Mombasa is a cosmopolitan coastal city with the largest port in East Africa and lies
between latitudes 3° 80' and 4° ]0' S and longitudes 39° 60' and 39° 80' E, with a total
landmass of 229.6 km2 and inshore waters covering 65 km2 (as shown in Figure 3.J and
Appendix 1). Mombasa County has a population of939,370 people of which 486.,924 are
male and 452,446 are female (KNBS, 20] 0). The County consists of 6 constituencies
namely, Kisauni, Mvita, Changamwe, Likoni, Jomvu and Nyali (IEBC, 2012). The
cosmopolitan nature of Mombasa combined with the presence of a youthful population
has created a suitable environment for commercial sex, child tourism and recreational
druguse (Kahuthia-Gathu et al., 2013; Korir, 2013).
Bomu Hospital is a registered non-governmental healthcare organization situated in
Changamwe Sub-County close to the Moi International Airport (at latitudes 40 l ' 28'
South of Equator and longitude 39° 46'57" East of the Greenwich Meridian), It is a
project of the Mkomani Clinic Society (MCS). In addition, MCS runs three other satellite
clinics in South Coast, Mariakani and at Wema Centre in Kisauni Sub-County. Bomu
Hospital offers a large range of programmes like separate Comprehensive Care Centres
foradults and children (MOH, 2011; Bomu Hospital, 2013).
83
1.75 3.5
I I I I t
7 Kilometers
I
Legend
• City
Constituency
Kisauni
.~
s
Figure 3.1: Map of Kenya and Mombasa County
Source: Courtesy of Regional Centre for Mapping of Resources for Development
84
Currently,Bomu provides free comprehensive medical services to more than 23,500
PLWHA from all over the Coast region through the hospital and its satellite clinics that
areassisted by the President's Emergency Plan for AIDS Relief (PEPFAR) funding.
Otherdonors include United States Agency for International Development (USAlD),
KenyaFamily Health Program, Japanese International Cooperation Agency, Canadian
International Development Agency, Pathfinder's International, European Union,
International Center For Reproductive Health, The Planned Parenthood Federation of
America, African Palliative Care Association, Academy for Educational
DevelopmentJIntemational Center for AIDS care and treatment Programs, New York
Universityand the Center for Disease Control (Bomu Hospital, 2013).
3.5 Sample Size
Samplesize determination is influenced by study design, prevalence of the attribute,
accessibilityto the participants, ethical issues and availability of financial resources. An
optimum sample is one that fulfills the requirements of efficiency, representativeness,
reliabilityand flexibility. At per time this study was designed, the H1Y prevalence among
PWID ranged between 43% - 49% (Deveau et al., 2006; Needle and Zhao, 20]0). Both
authorsreported this as an underestimate. The prevalence of my in PWID was estimated
to50% and the formula below was used (Mugenda and Mugenda, 2003).
..
85
D =the desired sample size (since the target population is greater than 10,000).
z = the standard normal deviant (as per area under normal curve at confidence level
95%),
p = the proportion ill the target population estimated to have the attributes being
measured.
q= l-p
d= the level of statistical significance set
n= (1.96f (0.5). (1- 0.5)
(0.05) 2
n "" 384 participants.
A total of 384 participants were to be recruited. Due to circumstances beyond the control
of the researcher like the general elections in 2013 and arbitrary eviction of drug users
from their havens by the County government, only 371 rDUs were enrolled.
3.6 Sampling Procedure
Respondent driven sampling (RDS), traditional snowball sampling and makeshift
outreach methods were used to recruit IDUs.
3.6.1 Respondent driven sampling
The RDS method is based on snowball sampling and allows researchers to make
estimates about hidden population such as the injection drug users, sex workers. and men
86
who have sex with men. This sampling technique has been used by several researchers
(Atkinson et al., 2011; Ulibarri et al., 2011; Medhi et al., 2012).
Recruitment using RDS was initiated with a number of purposefully selected "seeds"
(individuals belonging to the study population who have influence over other members
being interviewed). Each seed was given three uniquely coloured coupons with which to
recruit peers (other eligible PWID) into the study. These recruited peers were considered
as the first wave of participants. Each participant in the first wave who completed the
interview was then provided six coupons with which to recruit their peers. Successive
waves of recruitment continued until the waves died (no more participants were being
enrolled) before the desired sample size was achieved. At this stage only 142 PWID had
been recruited. SnowbalJ sampling and makeshift outreach methods were then used.
3.6.2 Snowball sampling
SnowbalJ sampling is a non-probability recruitment technique that is appropriate to use in
hidden populations. The recruited PWID were asked to assist researchers in identifying
other potential subjects. The chain referral system continued until it was exhausted. This
method has been used by researchers targeting similar groups (Rafiey et al., 2009;
Atkinson et al., 2011; Shannon et al., 2011; Suohu et al., 2012).
3.6.3 Makeshift outreach method
To cover up for the deficit, makeshift outreach method was used. This involved direct
recruitment from drug havens by a rehabilitated former IDU Among others, the method
87
haspreviously been used by Gyarmathy et al, (2009), Williams et al, (2009) and Suohu et
al, (2012).
3.7. Data Collection Methods
The roUs were defined as persons who injected drugs for recreational purpose at least
once a day regularly in the last one month prior to the commencement of study.
Observation of the needJe scars was a necessary criterion for their enrollment. Data
collection methods varied depending on the objective as follows:
3.7.1 Interview Schedule
Structured interview schedule was used to capture the socio-demographic characteristics
and drug use pattems. The information was collected by research assistants who are
trained community health workers. They read the questions exactly as they appeared on
the interview schedule to the participants in English or Swahili. TIle choices of answers
to the questions were both fixed (close-ended) as well as open-ended as shown in
Appendix 2.
3.7.2 Anthropometric Measurements
Nutritional status was determined using anthropometric measurements which included
weight, standing height, bust, waist circumference, hip circumference and mid- upper
arm circumference as per anthropometry procedures manual by National Health and
Nutritional Examination Survey (CDC, 2009). In addition, in order to assess the
heamogloblin level a full haemogram was carried out.
88
Heightwas measured in centimeters using Health 0 Meter PORTROD, Professional Wall
MountedHeight Rod. Participants were asked to remove their shoes, stand straight with
both feet facing flat-forward and their back against the wall. To measure weight (in
kilograms), each respondent was requested to remove their shoes, purse and anything else
thatwas heavy. The respondent stood on the scale platform, facing the vertical portion of
thescale with weight evenly distributed between both feet (CDC, 2009).
Todetermine bust circumference, a tape measure was placed around the back and across
thenipples. It was wrapped around loosely. The waist circumference was determined by
first identifying the lowest point of the last rib and the crest of the ilium (top of the hip
bone). Once the upper hip bone was located, a tape measure was placed around the
abdomenhorizontally and at the belly button or just above it. The tape measure was snug
but tight enough not to cause compressions on the skin. The hip circumference was
obtained by positioning the tape measure horizontally around the maximum
circumference of the buttocks. For women this was at groin level while for men it was 2 -
4 inches below the navel. All measurements were recorded in centimeters. Waist. hip ratio
(WHR) was obtained by dividing waist circumference by hip circumference.
The mid-upper arm circumference (MUAC) was obtained using MUAC tape measure.
With the arm bent and held against the torso, the summit of the shoulder (the acromium)
to the tip of the elbow (the olecranon) was measured; the mid-point was marked and this
iswhere the circumference measure was then taken. The arm was left to hang in a relaxed
position and the armband (strip) was contacting the entire circumference of arm, this was
"
89
doneby applying finger pressure. It was not so tight to cause the skin to bulge around the
tape and neither was there any space left between the tape and the skin. The
circumference was recorded to the nearest millimeter (eDe, 2009; WHO, 2011b).
Body mass index (BMI) also referred to as Quetelet index, is a statistical measurement
which compares a healthy body weight based on how tall a person is. It was determined
using the universally formula of kg/m". Based on the WHO guidelines, a BMl of less
than ]8.5 kg/rrr' was considered underweight indicator of undernutrition, while a BMJ
greater than 25 was considered overweight and above 30 was considered as obese
(FANTA, 2013).
To determine the heamogloblin (Hb) level, approximately 5 ml of venipunctnre blood
was drawn a full haemogram was carried out using Midray Analyzer CSC-5380, Mindray
Medical International Limited). Haemoglobin that was equal or more than 12 g/dl, for
women and 13 g/dL for men was considered as non-anaemia while Hb of less than 12
g/dL in women or. 13 g/dL in men was classified as anaemia (WHO, 20 11c).
3.7.3 Tuberculosis Diagnostic Methods
All the participants received health education on TB and those who had a self reported
history of persistent cough for more than two weeks, fever, chest discomfort and
sweating at night were screened for TB infection ceDe, 20l2f). The screening process
was carried out by a registered medical practitioner while the sputum was obtained by a
90
registered laboratory technologist. The TB samples were handled at a Physical
Containment Level 3 (APe3) laboratory which had bio-safety cabinets.
3.7.3.1 Collection of Sputum
The patients were given instructions on how to collect the sputum. One spot and two
early morning 5 ml specimens of sputum were obtained on three different consecutive
days for TB diagnosis (WHO, 2008a). This was done in a Sputum Collection Booth
(model VCM-1500N 2 ) to prevent TB from spreading.
3.7.3.2 TB Sputum for Acid Fast Bacteria (AFB) Microscopy
Using an application stick, the most mucoid part of the sputum was placed on the slide in
an oval shape (2-3 em in length and] -2cm width). Carbol Fuchsin was applied on the
slidewhich was gently heated until it steamed. The hot slide was allowed to sit for 3 to
5 minutes and afterwards rinsed with tap water. The slide was flooded with a
decolorizor (3% hydrochloric acid in isopropyl alcohol) and rinsed subsequently with tap
water. The slide was next flooded with Methylene Blue (in order to provide a contrasting
background), rinsed with tap water and blot dried. The non-acid-fast bacteria picked up
Methylene Blue, to become blue while the acid-fast bacteria retained Carbol Fuchsin
colour and appeared red when viewed under the microscope. A drop of oil was put on
one end of the smear and the slide was viewed under oil immersion lens (Af'Hl, 2009)"
The findings were reported as negative where no AFB was found in at least 100 fields
and exact figure out of 100 in slides with ]-9 AFB per 100 fields while slides with 10-99
•
'".
91
AFBper 100 fields were reported as (+). On the other hand, slides with 1-10 AFB per
fieldwith count of at least SO fields were reported as (++) while slides with more than 10
AFBper field with count of at least 20 fields were reported as (+++) as guided in APHL
(2009). A bacteriologically confirmed TB case was defined as a positive by smear
microscopy, culture or WHO-approved rapid diagnostics such as Xpert MTBIRIF (WHO,
20l3i). The clients who tested TB positive were enrolled into the TB programme at
Bomu Hospital or Coast PGH for treatment and psycho-social support. Infectious waste
was collected in an autoclavable bag and autoclaved before incineration.
3.7.3.3 Drug Susceptibility Testing
Drug susceptibility testing (DST) of Mycobacterium tuberculosis was carried out after
culture was isolated from clinical specimens. Lowenstein-Jensen (LJ) media was used for
mycobacterial culture. A homogeneous suspension of growth was inoculated into growth
control (GC) tubes and drug-containing LJ media tubes. The proportion method (critical
proportion of 1% of growth for all the four drugs) was used to determine the percentage
of growth (number of colonies) of a defined inoculum on a drug-free GC media versus
growth on culture media containing the critical concentration of an anti- TB drug (Table
3.1). This was followed by incubation of the media at 36 ± 1°C. The inoculated media
were examined for contamination after 1 week of incubation and for DST interpretation
after 4 and 6 weeks of incubation. Results after 4 weeks were considered as provisional
while after 6 weeks were definitive and interpretation of results was based on the later.
92
Drug Isoniazid Rifampicin Ethambutol Pyrazinamide
---
Critical concentration (ug/ml) 0.2 40 2 4
Table 3.1: Critical concentrations of first-line drugs
Source: (WHO, 2008b).
A strain was considered to be resistant if the medium containing the critical concentration
of the corresponding drug showered more colonies than the growth control (GC) with the
1% inoculum. The result was interpreted and reported as susceptible or resistant.
Borderline cases (about 1% growth on drug-containing medium) were reported as
resistant and retested (WHO, 2008b).
Growth of more than 20 colonies on control rubes and no growth on drug tubes were
reported as sensitive to all drugs. Growth of more than 20 colonies on control tubes and
number of colonies on Isoniazid, Rifampicin, Ethambutol and Pyrazinamide tubes of
more than or equal number of colonies on control corresponding tubes of 1/100 was
reported as resistant to Isoniazid, Rifampicin, Ethambutol and Pyrazinamide respectively.
Growth of more than 20 colonies and number of colonies on Isoniazid, Rifampicin,
Ethambutol and Pyrazinamide tubes of less number of colonies on respective control
tubes 11100 was considered as sensitive to Isoniazid, Rifampicin, Ethambutol and
Pyrazinamide correspondingly. In cases where there was no growth on control tubes or
lessthan 20 colonies on GC and no growth on drug tubes, it was reported as invalid result
and the process was repeated. Multi drug resistant TB was defmed as resistance to
93
isoniazid and rifampicin, with or without resistance to other first-line drugs (WHO,
2008b;WHO, 2012b; TB CARE 1,2014).
3.7.4 HIV Testing
All the participants received free my education after which they were allowed to make
personal informed choices on either to undergo an HIV test or not. Upon obtaining
written informed consent, they completed the interview schedule after which each
participant underwent pre-test HIV counseling. Provider-Initiated HIV Testing and
Counseling was carried out by trained YCT counselors. The HIV testing was purely on
voluntary basis and those who decided not to undergo the test at this stage were not
included in the study.
3.7.4.1 Blood Collection
Approximately, 5 ml of venipuncture blood was drawn from each participant in EDTA
anticoagulant tubes and used for conducting other tests cited within this study like full
haemograrn, CD4 count and viral load. A drop of the blood was used for HlV testing.
The HfV -I status was determined using Determine ™ (Abbott Laboratories, Tokyo,
Japan) and positive serological results were confirmed by Unigold" (Trinity Biotech
PJc. Bray, Ireland) as per the Kenya National Guidelines for my Testing and Counseling
(NASCOP, 2010). The results were ready within 5 to 10 minutes. Each participant
received post test counseling and those who tested HIY positive were referred to the
Comprehensive Care Centre and enrolled into the Hl V ART treatment and psychosocial
94
support program at Bomu hospital or Coast General Hospital. All participants were
encouraged to join the recreational drug users support group hosted by Bomu hospital.
3.7.4.2 RNA Extraction and Quantitation of HIV-l Viral Load
The HIV-I viral load was quantified using the automated Abbott m Sample Preparation
System (m2000sp) that has automated sample extraction, amplification and detection
according to the manufacturer's instructions (Abbott Molecular Inc., Illinois, U.S.A).
This was achieved via RNA extraction from 0.2 mL of plasma using the 0.2 mL plasma
RNA extraction and master mix addition protocol by the Abbott m2000sp sample
preparation system. The master mix containing the viral RNA (vRNA) was then
transferred to Abbott m2000rt instrument for viral load detection using the program for
O.2mL RNA amplification with a lower limit of quantitation at 150 (2.18 logl O)
copies/nil of plasma. This method has been previously by Thao et at. (2012).
3.7.4.3 Reverse Transcriptase-Pf.R
To convert vRNA to cDNA, 5 ul. from the remaining BilL of the RNA extract in the
Abbott m2000sp deep well plate was used as a template and 0.16 J.lMeach of primers;
Nyupol_7 (5 '-GGGAATTTTCTTCAGAGCAG-3') and Nyupol_8 (5'-
TCTTCTGTCAATGGCCATTGT-3'). This was performed by one-step RT-PCR in a 25
ul, reaction consisting of; 0.5 ul. SuperScriptTM III one step RTlPlatinumH Taq high
Fidelity Enzyme Mix in a 1x reaction buffer mixture containing Mg2+ and
deoxyribonucleotide triphosphates (dNTPs) (lnvitrogen, Carlsbad, CA). Thennocycling
conditions for reverse transcriptase PCR were set with an initial cycle RT step at 5SOC for
95
30 min and 94°C for 2 min, followed by 40 cycles of PCR at 94°C for 15 see, 46°C for 30
see,nOc for 1 min and an extension at 7i)c for 5 min.
The amplified viral cDNk encording the partial pol-gag gene was nested in a 25 ~L
master mix reaction consisting of 1X P 1.5mM MgCI-.2, 1U/~L Taq polymerase
(KemTaq®), 200 ~M of each dNTP (Invitrogen, Carlsbad, CA), 3~1 of template DNA
and0.5 ~M of each inner primer; Nyupol_9 (5'-TCCTT AACTTCCCTCAAATCAeT~3')
and Nyupol_lO (5' -CTGGCACGGTTTCAATAGGACT-3'). Amplification was done
with an initial denaturation of 94°C for 4 minutes followed by 40 cycles of 94°C for
15seconds, 46°e for 30 seconds, and noe for 1min, with a final extension of noe for
5minutes. The resulting PCR products were electrophoresed in 1.5% ethidium bromide
stained agarose gel and visualized under ultraviolet light. Presence of 297 bp fragment
was indicative of successful amplification.
3.7.4.4 DNA Purification and Sequencing
The resulting PCR amplicons were purified with QIAquick PCR purification kit (Qiagen,
Valencia. CA) following manufacturer's instructions (5.7.3). Direct sequencing of the
PCR amplification products was performed using the inner primers (Nyupol_9 and
Nyupol_lO) with the Big Dye Terminator sequencing chemistry in both directions. The
sequencing products were analyzed on an ABI PRlSM® 3100 Genetic Analyzer and
DNA base calling performed using the DNA Sequencing Analysis software V3.7. The
sequence data was then imported into the Genetyx-Windows computer software version
96
9.1.0 (Genetyx Corporation, Tokyo, Japan) to assemble the two sequence segments into a
single contiguous sequence.
3.7.5 Hematological Profile
Full haemogram was determined usmg a BC-3200 mindray haematologic analyser
(Mindray Inc., NJ). These included: leucocyte counts (total leukocytes, and numbers and
percentages of lymphocytes, monocytes, neutrophils, eosinophils and basophils);
erythrocyte indices (red blood cells [RBC], haemoglobin [Hb] levels, haematocrit [Hct],
mean corpuscular Hb [MCH], mean corpuscular Hb concentration [MCHC], mean cell
volume [MCV] and red cell width [RDW]); and thrombocyte indices (platelets. mean
platelet volume [:MPV],PCT and platelet width [PDW]).
3.7.6 CD4+ T Cell Enumeration
Baseline CD4+ T cell counts were determined using a FACSCalibur flow cytometer
(Becton-Dickinson, NJ) equipped with automated acquisition and analysis software. This
was done by placing 5 JlI of whole blood samples in a tube and RBC lysis buffer was
added. After 5 minutes incubation, the cells were washed and fluorescent-tagged
antibodies anti-CD3, anti-CD4, anti-CD19 and anti-CD45 were added. The cells were
incubated for 30 minutes after which the samples were washed and CD4+ T cells
enumerated on the flow cytometer. Individual test results were reviewed to confirm the
accuracy of the automated software analysis.
97
3.8Vital Signs
3.8.1 Body Temperature
It was measured using a clinical thermometer which was placed under arm with the bulb
in the center of the armpit. The ann was pressed against the body for 5 minutes. The
thermometer was removed and readings recorded in degrees Celsius. Pulse rate which is
thebeat of the heart that can be felt in any artery that lies close to the skin per minute. It
was determined by placing the tips of the index and second fmgers of one hand on the
insidewrist of the participants hand. The fingers were positioned just below the base of
thethumb to take the radial pulse at the wrist for one minute.
3.8.2Blood Pressure
To obtain blood pressure, participants were asked to remove any constricting clothing
from their upper left arm, to sit straight up in a chair with their feet resting flat on the
floor and not cross their legs. The blood pressure cuff was loosened and slid on their Jeft
arm through it until it was positioned about 112 inch above the elbow. The cuff was
inflated by rapidly pumping the inflation bulb until the correct pressure was reached. The
inflation bulb was slowly released until the numbers came to rest, then the current blood
pressure readings were recorded.
3.9 Pilot Study
A pilot study was carried out from Bomu Hospital (Wema centre satellite clinic in
Kisanni Sub-County) to assess whether the proposed methods and procedures were
applicable. This was to help in testing logistics that could have exposed any deficiencies
98
to the main study. The quality and the efficiency of the main study were improved. The
participants from this centre were not included in the actual study.
3.10 Inclusion Criteria
1. Only individuals who had practiced injection drug use in the last Imonth were
included in this IDU study.
2. These individuals were all adults.
3. They must have consented to voluntarily participate and undergo an HIV test.
4. Those with visible needle scars.
3.11Exclusion Criteria
1. Other drug users who were non IDUs were excluded from the study.
2. Injecting drug users who were minors were not included.
3. Participant who were not willing to give a written consent or undergo an HIV test
were excluded.
4. Those without needle scars were excluded.
3.13EthicaJ Consideration
Thestudy was conducted according to the Helsinki Declarations and ethical approval for
the study was sought and granted from Kenyatta University Ethical Review Committee
(PKUO 19/116 of 2012, Appendix 4). Permission was granted from Ministry of Health,
Mombasa County (MOH Ref ADMJ/5/371121 , Appendix 5). Written informed consent
99
either in English or Swahili was obtained from each participant before enrolment
(Appendix 6 and 7 respectively).
Confidentiality was ensured as no individual name was used instead the participants were
assigned study numbers. The participants benefited from free health education on HIV,
tuberculosis, hepatitis Band C, STIs, personal hygiene and nutrition. The HlV positive,
TB positive as well as Hl V-TB co-infected participants were referred to the
comprehensive care unit of either Bomu Hospital or the Coast General Provincial hospital
depending on participant's preference. All participants were encouraged to join the
recreational drug users support group hosted at Bomu Hospital.
3.14Data Analysis
Data analyses were conducted using SPSS, version 19 (IBM SPSS Inc., New York,
USA), all tests were two-tailed and P<O.05 was used for statistical inferences for
objectives one to four. Pearson's Chi-square or Fisher's exact tests (where the expected
frequencywas less than five) were used for comparing distribution in the proportions of
categoricalvariables between Hl V infected and uninfected participants.
Agecomparison between Hl V infected and uninfected was performed using the Mann-
Whitneytest. In order to identify predictors of HIV infection, binary logistic regression
analyses were performed using HlV status as the dependent variable and the socio-
demographic, sexual practices and drug use information as the independent that is the
predictor variables. Since age, education, employment, religion and residence are
associatedwith injection drug use, the potential confounding effect of these variables was
-'
100
controlled for (Brodish et al., 2011). Only variables found to be significantly associated
withmy infection at P<O.l in the Chi-square and Fisher's exact tests were included in
theregression analyses.
Data for nutritional status was presented as .medians (IQR) or proportions (n %) while
anaemia, BMI, CD4 and viral load classification were based on WHO criteria. Statistical
comparison between groups was performed by Mann-Whitney test. Comparative
distribution in the proportions of categorical variables between non-IDUs and IDUs was
analysed using Pearson's Chi-square test. Fisher's exact test was used where the expected
frequency was less than five. Only variables found to be significantly associated with
nutrition at P<O.1 in the Chi-square and Fisher's exact tests were included in regression.
Binary logistic regression was conducted using BMJ<18.5 kg/rrr' (malnourished) as
dependent variable and BMI218.5 kg/m' as the reference group controlling for age and
gender. in HlV negative IDUs and age, gender and ART use in the HIV positive lDUs.
Data are presented as odds ratios (OR) and 95% confidence interval (Cl).
Data the tuberculosis prevalence was presented as percentage, n (%) and Fisher's exact
test was used in comparing proportions between the groups. All tests were two-tailed and
P<O.05 was used for statistical inferences. Binary logistic regression controlling for age
and gender in HIY negative IDUs and age, gender and ART use in the HIV positive IDUs
was carried out. Data were presented as odds ratios (OR) and 95% confidence interval
(Cl). Data for mv Subtypes was tabulated and presented as number (%) of participants
as illustrated in the next chapter.
I<ENYATTA UNIV R ITY-
~~.
101
CHAPTER FOUR: RESULTS AND DISCUSSION
4.1 The Social-demographic Characteristics and Sexual Practices of the PWID in
Mombasa County
The distribution of socio-demographic factors in the HIY infected (n= 157) IDUs relative
to HIY uninfected (n=214) IDUs as presented in table 4.1. The proportion of the female
gender (P<0.0001), protestant religion (P<O.OOOI), marital separation (P<O.OOOI), and
sex work, entertainment or beauty therapy occupations (P<O.OOOl) were significantly
higher among HIY infected IDUs. Although most IDUs earned at least US$ 174 a month,
the proportion of low income levels (US$ <174) was higher among HIY uninfected IDUs
(P=O.015). However, the distribution of age (P=O.271), residence (P=0.741), education
(P=O .170), and employment (P=O .167) did not differ significantly by HIY infection
status (Table 4.1).
The gender distribution in the injection drug users indicated 86% HIV-1 infection rate
among female IDUs. The subsequent regression analyses illustrating odds of 19 times for
HIV-I infection among the females implies that this special group was at an exceedingly
high risk of acquiring my -1 infections. This finding was consistent with previous
studies among Tanzanian injection drug users showing that females were 64% likely with
odds of nearly 5 times for testing positive for HlV-1 (Williams et al., 2009). Females
among the urban poor in Kenya have remained more vulnerable to HIV-l infections due
to the fact that they are more excluded from mainstream economic activities. In addition,
they are more affected by the ravages of poverty (Madise et al., 2012).
103
are associated with increased odds for HlV-1 infections among IDUs. These
observations are partly consistent with studies among South African IDUs illustrating
that drug users exchange sex for money to buy drugs. In addition, drug injecting sex
workers in South Africa frequently use drugs before, during and after sex at the same
time share drugs with clients (Parry et aI., 2009). TIle observations among the Mombasa
injection drug using population suggest that entertainment and beauty therapy industries
are important in fueling the mv epidemic in the population. This premise is in
concordance with observations in Vietnam indicating that entertainment venues are
frequent points for initiation of drug use (Thao et aI., 2006). The findings are also partly
consistent with studies among Chinese female sex workers injecting drugs showing a
higher risk of HlV infection in those working in entertainment venues, beauty salons or
saunas (Wang et al., 2009).
In contrast, to the sex work and entertainment or beauty therapy industries, small
business and passenger service vehicle (PSV) operators were associated with lower odds
for HlV-I infections among injection drug users. These findings clearly illustrate that
engaging in viable and consistent income generating occupations is an important
deterrent for preventing transmission or acquiring HIV infections. Such individuals may
be injecting less frequently and/or have money to buy drugs, needles and syringes hence
less likely to engage in sex for money to buy drugs or sex for drugs or share injecting
equipment. These occupations may thus be used for spreading HlV prevention social
marketing interventions among injection drug users (Gibson et al., 2010).
104
On the contrary, long distance truck drivers who have been associated with higher risk of
Hl'V infection and drug use (Morris and Ferguson, 2006), PSV operators injecting drugs
in the current study appear to be at reduced risk for HlV -1 infections. The reasons for
this peculiar observation may be related to their long working hours and using drugs for
alertness while driving and sedation when on short breaks. The bulk of PWID reporting
working in small businesses were engaged in selling of household items, groceries and
cart pushers. Again these are activities that are energy supping and require long working
hours hence such individuals are less likely to engage in risky sexual activities.
From this study, having an income is an important element of reduced odds for having
mV-I infection. The finding of low income levels predicting low odds for mV-I
infection partly relates to class subsets in the drug injecting communities at this coastal
region of Kenya. These results are also partly consistent with studies in Canada showing
associations between stimulant drug use and engaging in low-threshold employment
(Debeck et al., 2011). In addition, studies among IDUs in the United States indicate that
income is a key determinant of low to high use and low to high risk classes of injection
drug users (Watson et al., 2013). Subsequently income levels may determine the
frequency of injection, affordability of drug injection equipment and involvement in risky
sexual practices such as sex for drugs and/or money to buy drugs.
105
Category HIV[+] pHIV[-]
Participants (n)
Female, n (%)
Age, yrs.
Residence
Informal and low income
Makeshift and streets
Middle and high income
Education
Secondary/college"
Primary
None
Marital status
Currently married
Divorced
Never married
Separated
Widowed
Religion
Catholic
Protestant
Muslim
Employment
Informal
Formal
Occupation
PSVoperators
Small business
CSW
Hospitality
Entertainment/beauty therapy
Others"
Income, dollars/month"
>231 100 (46.7) 88 (56.1)
174-231 41(19.2) 39(24.8)
116-173 40 (18.7) 18 (11.5)
0-115 33 (15.4) 12 (7.6)
214
14 (6.5)
31.7 (9.1)
157
86 (54.8)
30.6 (6.6)
111 (51.9)
58(27.1)
45 (21.0)
80 (51.0)
39 (24.8)
38 (24.2)
66 (30.8)
138 (64.5)
10 (4.7)
35 (22.3)
112 (71.3)
10(6.4)
57 (26.6)
26 (12.1)
86 (40.2)
42 (19.6)
3(1.4)
]7(10.8)
28(17.8)
44 (28.0)
66 (42.0)
2 (1.3)
43 (20.1)
20 (9.3)
151 (70.6)
43 (27.4)
36 (22.9)
78 (49.7)
]72 (80.4)
42(19.6)
]35 (86.0)
22 (14.0)
102 (47.7)
66 (30.8)
5 (2.3)
17 (7.9)
4 (1.9)
20 (9.3)
34 (21.7)
20 (12.7)
32 (20.4)
13 (8.3)
41 (26.1)
]7 (10.8)
<0.0001
0.271a
0.741
0.170
<0.0001
<0.0001
0.167
<0.0001
0.015
Table 4.1: Socio-demographic characteristics of IDUs in Mombasa, 2012-2013
Data are presented as numbers and proportions (%) of subjects, unless otherwise indicated.
Statistical analyses were conducted using the Pearson's chi-square or Fisher's exact tests as
appropriate. "Mann-Whitney test. bChi-square test was based only on cells with at least 5 counts.
'Others constituted fishermen, house helps, beggars, garbage collectors, clerks, masons, artisans
and petty thieves. PSV, passenger service vehicles (Matatu drivers, taxi drivers, conductors and
touts). dAs at September 30th 2013, US$ was equivalent to KShs. 86.8. Values in bold indicate
significant P-values.
106
Sexual practices were examined among IDUs presenting with or without HIV infection.
Sexual orientation did not differ significantly between the groups (P=O.225). However,
the proportion of IDUs reporting early age of sexual debut (P<0.0001), at least two
sexual partners (P<O.OOO I), unprotected sex (P<O.OOOl), sex for police protection
(P<O.0001), sex for drugs (P<O.OOOl) and an STI (P<0.0001) were significantly higher
among those infected with HIV (Table 4.2).
Characteristic HIV(-] HIV(+] P
Participants (n) 214 157
Sexual orientation
Bisexual 2] (9.8) 13 (8.3)
Heterosexual 164 (76.6) 131 (83.4) 0.225
Homosexual 29 (13.6) 13 (8.3)
Age of sexual debut
<15 48 (22.4) 76(48.4)
16-20 123 (57.5) 62 (39.5) <0.0001
>20 43 (20.1) 19 (12.1)
Number of sexual partners
0 25 (11.7) 5 (3.2)
I 91 (42.5) 49 (31.2) <0.0001
2-5 88 (41.1) 73 (46.5)
>5 10 (4.7) 30 (19.1)
Hadpenetrative sex in the past year 165(77.1) 144 (91.7) <0.0001
Had sex without condom 19 (8.9) 49 (31.2) <0.0001
Had sex for police protection 6 (2.8) 37 (23.6) <0.0001
Had sex for drugs 20 (9.3) 39 (24.8) <O~OOOI
Had STI in the past year 52 (24.3) 102 (65.0) <0.0001
Table 4.2: Sexual practices of PWID in Mombasa, Kenya, in 2012-2013
Data are presented as proportions, unless otherwise indicated. Statistical analyses were
conducted using the Pearson's chi-square or Fisher's exact tests as appropriate. STI
(sexually transmitted infections).
107
Analysis of sexual practices of PWID showed that nearly 50% of the individuals that
reported sex debut at age less than 15 years were HlV infected. These results remained
predictive of the HIV sero-positivity even after controlling for confounders in the
regression analyses. At a young age an individual is still a minor and incapable of
making informed decisions regarding safer sex. In addition, such underage persons are
prone to sexual and or physical abuse that is frequently associated with risk of HIV
acquisition. In Kenya, 21% of young aduJts aged] 5 to 24 years are reported having bad
sexual debut before] 5 years of age compared to 33.4% among IDDs in the current study
(NASCOP,2013). Young people in Mombasa may be engaging in drugs and prostitution
at an early age to escape the ravages of poverty leading to a higher risk of infection
(NACADA, 20]2; NACC and NASCOP, 2012).
The study further showed that having at least two sexual partners increased higher odds
for HIV infection. Multiplicity of sexual partners often increases the risk of acquiring
sexually transmitted infections (STIs) including HIY (Khan et al., 2012). In the current
study individuals that reported experiencing an STI in the past year also had higher odds
forHIY infections.' Consistent with previous studies in the same area showing that IDDs
report multiple past and new sex partners (Brodish et aI., 2012). These findings clearly
indicate that multiplicity of sex partners is an important risk factor for acquisition of HIY
in the drug injecting communities. Multiplicity of sex partners is one of the factors
identified as fueling the Hl V epidemic in Kenya mainly through increasing STIs which
promote efficient transmission of ill V (NASCOP, 20l3).
108
Sexual activity m the past 12 months and engagmg m unprotected sex were also
identified as important sexual practices predicting mv infection in the present study.
These findings are consistent with the results of the 2012 KAIS report for the general
Kenyan population (NASCOP, 2013). AdditionaJIy, similar studies have shown
associations between multiple sexual partnerships, unprotected sex and trading sex for
money, in HIV sero-positive Tanzanian heroin users (Ross et 01., 2008; Atkinson et 01.,
20JJ). Importantly, results in this study showed that sex for drugs and sex for police
protection were associated with higher odds of having HIV infection. These fmdings are
in part, parallel to previous studies in South Africa showing complex interacting
economies of drugs and sex work whereby sex is exchanged for drugs (Needle et 01.,
2008). findings from this study also partly mirror studies in Pakistan indicating that
harassment, abuse and exploitation of most at risk populations (MARPs) like PWID, sex
workers and MSMs. Perpetrator of these atrocities range from non-state actors such as
relatives and sex worker clients to state actors like the police (Mayhew et 01.,2009).
These findings were concurrent with the work of McCurdy et 01, (2006), Parry et al,
(2008), Williams et 01, (2009), McCurdy et 01, (2010), Brodish et 01, (2011), Cavlek et 01,
(2011),Majidpour et at, (2012) and the 2012 KAIS report, NASCOP, (2013). The family
unit, STIs and income in these studies were significant determinants of HIV infection
among rODs and should be targeted for effective interventions.
109
4.2 Drug Use Patterns of HIV Infected and Non- infected IDUs of Mombasa County
Heroin was the most frequently injected drug in the HlV infected and uninfected lDUs
(P<O.OOOl) but the proportion of cocaine users was higher in the Hl V infected group
(P<O.OOOl). The proportion of IDUs using other injecting drugs, flunitrazepam and
diazepam did not differ significantly between the HIV positive and negative groups
(P=O.837). Although most of the IDUs in both groups injected for at least twice a day,
the proportion of those injecting once daily was higher among the Hl V infected group
(P=O.004). In contrast, the proportion of IDUs reporting having been injecting for less
than six months was higher among HIV uninfected IDUs (P=O.OOl).
The findings of polysubstance use among IDDs have been summarized in table 4.3.
Among the non-injection substances, the proportion of IDUs using alcohol (P<O.OOOl),
cocktail (P=O.002), and khat (P=O.002) was higher in the HIV infected group. However,
mono-substance. usage, that is, bhang (P=0.464), brown sugar (P=O.643), cigarette
(P=O.65 1), or rohypnol tablets (P=O.265) was not significantly different between the
groups. Additional analyses on polysubstance use showed that injection of heroin or
cocaine (as a primary drug) and use of any four non-injection substances (Group V) was
higher among HIV infected versus uninfected IDDs (P<O.OOOl) while injection of the
primary drug (Group I), and anyone (Group Il), two (Group III), or three (Group IV)
non-injection substance did not differ significantly between the groups (P>O.05 for all) as
shown in table 4.3.
110
Category HIV(-] pHIV(+]
214Participants (n)
Injection drugs
Cocaine
Heroin
Heroin -cocaine
Oilier injection drugs
Diazepam (valium)
Flunitrazepam (rohypnol)
Frequency of injection, per day
Once
Twice
Thrice
>3 times
Duration of injection
<6 mos.
6-11 mos.
1-3 yrs,
>3 yrs.
Non-injection drugs
Alcohol
Bhang
Brown sugar"
Cigarette
Cocktail"
Diazepam
Khat
Rohypnol tablets
Poiysubstance use
Group I 6 (2.8) 5 (3.2)
Group II 50 (23.4) 25 (15.9)
Group III 7] (33.2) 39 (24.8)
Group IV 67 (3] .3) 37 (23.6)
Group V 19 (8.9) 39 (24.8)
Group VI ] (0.5) 12 (7.6)
Needle and syringe sharing 50 (23.4) 50 (31.8) 0.076
Flushing of blood 43 (20.1) 15 (9.6) 0.006
Table 4.3: Drug use patterns among IDUs in Mombasa, Kenyan in 2012-2013
]9 (8.9)
191 (89.3)
4 (1.9)
16 (7.5)
12 (5.6)
13 (6.1)
75(35.0)
95 (44.4)
31 (14.5)
40 (18.7)
30 (14.0)
76 (35.5)
68 (31.8)
37 (17.3)
102 (47.7)
30 (14.0)
144 (67.3)
54 (25.2)
2 (0.9)
51 (23.8)
114 (53.3)
]57
42 (26.8)
112 (71.3)
3 (1.9)
10 (6.4)
2 (1.3)
25(15.9)
36 (22.9)
76 (48.4)
20 (12.7)
8 (5.1)
21 (13.4)
62 (39.5)
66 (42.0)
82 (52.2)
81 (5l.6)
19 (12.1)
110 (70.1)
64 (40.8)
4 (2.5)
61 (38.9)
91 (58.0)
<0.0001
<0.0001
0.837
0.004
0.001
<0.0001
0.464
0.643
0.651
0.002
0.002
0.265
0.999
0.089
0.086
0.103
<O~OOOI
Data are presented as proportions, unless otherwise indicated. Statistical analyses were
conducted using the Pearson's chi-square or Fisher's exact tests as appropriate. "brown sugar,
crude heroin. "cocktail, mixture of cigarettes and bhang. Group I, heroin or cocaine only
(monosubstance). Group II, heroin or cocaine and any other substance. Group III, heroin or
cocaine and any other two substances. Group IV, heroin or cocaine and any other three
substances. Group V, heroin or cocaine and any other four substances. Group VI, heroin or
cocaine and any other five substances. Values in bold indicate significant P-values.
III
Consistent with previous studies (Ross et al., 2008; Brodish et al., 2011), heroin was the
most frequent injection drug reported in bothHIV infected and uninfected injection drug
users. In addition, at least 26% of H1Y positive injection drug users reported injecting
cocaine. Although heroin appears to be the most common injection drug in eastern and
southern African countries (Ross et aI., 2008; Brodish et al., 2011; Trenz et al., 2013),
cocaine is increasingly becoming available. While all the IDUs injected for at least twice
daily, frequency of injection for once daily was higher among H1Y infected IDUs. These
observations are likely due to the fact that new initiates may be unaware of safer needle
use practices. Additionaly, they may lack money to consistently buy new needles.
The results are also consisted with studies carried out in Tanzania that reported less
frequent injection corresponded to increased risk of infection due to sharing of needles,
large sexual networks, lack of financial stability and low negotiating power of younger
recruits (Williams et al., 2009). In contrast, longer injection duration increases the risk of
exposure to HIY predominantly through increased probability of sharing infected needles
and syringes since needle and syringe sharing in the current study was predictive of
higher odds of HIY infection. The findings of lower odds for HIV infection for blood
flushing IDUs could be related to increased awareness of my prevention and adherence
to measures for reducing re-infections like auto-flushing or injection sere-sorting as
observed among IDUs in the USA (Mizuno et al., 20] l ).
Use of non-injection drugs among IDUs was also reported in this study. While the
consumption of bhang, brown sugar, cigarette, and rohypnol tablets was similar in the ..
112
infectedand uninfected population, alcohol, khat and cocktail consumption was higher in
theHlV infected individuals and predicted higher odds of mv infection. These findings
are consistent with previous studies in Russia that illustrated alcohol and cocktail
consumption is high in injection drug users and correlate with HlV infection (Abdala et
aI., 20] 0). Of significance are findings presented here showing that alcohol, cocktail and
khatconsumption is also associated with higher odds of having HlV infection among the
Kenyan injection drug using communities in Mombasa.
This study is possibly the first to show that khat predicts increased probability of HlV
infection among IDUs in Kenya. Khat is normally chewed for recreational purposes and
it contains a number of stimulants. It is possible that khat interaction with other
substances consumed by the IDUs increases the desire for sex and interferes with
decision making (Berhanu et ai., 2013; Tadesse et ai., 2013). In fact, khat use has been
associated with younger age of sex debut and baving multiple sex partners (Malaju et ai.,
2013; Tadesse et al., 2013; Tilahun et al., 2013. Furtbermore, alcohol use and khat
chewing has been associated with Hl V infection in Ethiopia (Ayenew et al., 2012).
These findings are in line with other studies that have reported that proportionally more
heroin IDUs declared to have used more than one drug in addition to heroin. For instance,
cocaine and benzodiazepines use has been documented (Ross et al., 2008; Williams et
al., 2009; Bradish et al., 2011; Trenz et ai., 2013; Havinga et al.. 2014). Nonetheless,
they deviate from the outcome of the studies by McCurdy et al. (2006) and McCurdy et
113
al. (2010) who reported high HIV incidence among IDUs in Tanzania who practiced
blood flashing.
4.3 Association of Socio-demographic, Sexual Practice and Drug Use Patterns in
Relationto HIV Status
To identify the predictors of HlV, binary logistic regression analyses were performed,
controlling for age, education, employment, religion and residence. Increased odds for
HfV infection was linked to females [OR, 18.609 (9.150-37.848); P<O.OOOl], marital
separation [OR, 2.676 (1.487-4.817); P=O.OOI] and divorce or widowhood [OR, 2.897
(L457~5.762); P=O.002].' In addition sex work [OR, 8.900 (2.610-30.350); P<O.OOOl];
entertainment and beauty therapy occupations [OR, 14.765 (3.979-54.794); P<O.OOOI] as
well as having penetrative sex within the past year [OR, 3.072 (1.552-6.083); P=O.OOl]
elevated the likelihood ofHlV infection.
Furthermore, the risk of HlV infection increased with reported younger age (<15 years)
of sexual debut [OR, 2.730 (1.340-5.560); P=0.006]; having two to five sexual partners
fOIt 3.766 (1.348-10.520); P=0.011) or at least five sexual partners [OR, 11.375 (3.312-
39.072); P<O.OOOI]; unprotectedsex [OR, 3.683 (1.986-6.833); P<O.OOOI]; sex for police
protection [OR, 8.888 (3.515-22.479); P<O.OOOl]; sex in exchange for drugs [OR, 2.762
(1.492-5.114); P=O.OOl] and STI [OR, 5.520 (3.364-9.056); P<O.OOOl].
Heroin [OR, 3.253 (1.823-5.803); P<0.0001] or cocaine use [OR, 3.509 (1.895-6.499);
P<O.OOO1]; injection for 6-11 months {OR, 3.072 (1.149-8.213); P=O.025], 1-3 years
.' ,
114
[OR,3.869 (1.633-9.168); P=0.002], or >3 years [OR, 6.509 (2.716-15.598); P<O.OOOl];
needle/syringe sharing [OR, 1.712 (1.052-2.788); P=O.031]; alcohol [OR, 4.618 (2.810-
7.590); P<O.OOOl], cocktail [OR, 1.916 (1.197-3.067); P=0.007]; khat [OR, 2.009 (1.251-
3.224); P=O.004]; and use of heroin or cocaine and any four [OR, 3.045 (1.631-5.684);
P<O.OOOl] or five [OR; 15.195 (1.870-123.473); P=O.OlI] non-injection substances also
increased the odds of HIV infection (Table 4.4). However, small business [OR, 0.354
(0.150-0.837); P=0.018]; passenger service vehicle operators [OR, 0.377 (0.171-0.831);
P=0.016]; monthly income levels ofUS$ 0-115 [OR, 0.451 (0.210-0.969); P=0.041] or
116-173 [OR, 0.426· (0.218-0.829); P=O.O] 2] and flushing of blood [OR, 0.462 (0.238-
0.897); P=O.024] were associated with low odds of having HIV infection among the
IDUs (Table 4.4).
llS
HIV[+] injection drug users
P-value
18.609 (9.150-37.848) <0.0001Female gender
Marital status
Separated
Divorcedlwidowed
Occupation
CSW
EntertainmentlBeauty therapy
Small business
PSV operators
Inconte, US$/ntO~
116-173
0-115
Age of sexual debut, yrs.
<15
Number of sexual partners
2-5
>5
Had penetrative sex
Sex without a condom
Sex for police protection
Sex for drugs'
STl
Injecting drugs
Any use ofheroin
Any use of cocaine
Duration of injection
6-11 mos.
1-3 yrs.
>3 yrs.
Needle and syringe sharing
Flushing of blood
Non-injecting drugs
Alcohol
Cocktail
Khat
Polysubstance use
Group V 3.045 (1.631-5.684) <0.0001
Group VI 15.195(1.870-123.473) 0.011
Table 4.4: Association of the socio-demographic characteristics, sexual practices and drug
use patterns in relation to IDUs HIV status, in Mombasa County 2012-2013
Characteristic OR (95% CI)
2.676 (1.487-4.817)
2.897 (1.457-5.762)
8.900 (2.610-30.350)
14.765 (3.979-54.794)
0.354 (0.150-0.837)
0.377 (0.171-0.831)
0.426 (0.218-0.829)
0.451 (0210-0.969)
2.730 (1.340-5.560)
3.766 (1.348-10.520)
11.375 (3.312-39.072)
3.072 (1.552-6.083)
3.683 (1.986-6.833)
8.888 (3.515-22.479)
2.762 (1.492-5.114)
5.520 (3.364-9.056)
3.253 (1.823-5.803)
3.509 (J .895-6.499)
3.072 (1.149-8.213)
3.869 (1.633-9.168)
6.509 (2.716-15.598)
1.712 (1.052-2.788)
0.462 (0.238-0.897)
4.618 (2.810-7.590)
1.916 (1.197-3.067)
2.009 (1.251-3.224)
0.001
0.002
<0.0001
<0.0001
0.018
0.016
0.012
0.041
0.006
0.011
<0.0001
0.001
<0.0001
<0.0001
0.001
<0.0001
<0.0001
<0.0001
0.025
0.002
<0.0001
0.031
0.024
<0.0001
0.007
0.004
Binary logistic regression was conducted such that all HIV infected injection drug users (n=157)
were modeled against all of the HIV negative injection drug users (n=214) controlling for age,
education, employment, religion and residence. Data are presented as odds ratios (OR) and 95%
confidence interval (CI)~ SW, sex worker; STI, sexually transmitted infections; Group V, heroin
or cocaine and any other four substances; Group VI, heroin or cocaine and any other five
substances.
,.
116
An overlap of socio-demographic characteristics, sexual practices and substance use
patterns predicted rnv infections in this study. These include the female gender, marital
separation, sex work or working in entertainment and beauty therapy venues, having had
penetrative sex in the last one year, early sexual debut, high risk sexual behaviour (like
multiple sexual partnership arising from sex for money, sex for police protection and sex
for drugs as well as unprotected sex), exposure to STI and high risk injecting practices
(like sharing of needles and syringes).
The increased risk of HlV acquisition arising from the overlap between sex work and
drug use has been widely documented. Female sex workers who are drug dependent are
more likely to engage in transactional sex while under the influence of substances in
addition to being acquiesced to clients' demands for unprotected sex, especially if offered
more money or drugs (Strathdee et 01., 2008; Patterson et 01., 2012; Shannon et al.,
2014). In some cases, drug use is involuntary because pimps and managers coerce sex
workers into drug use as a means of control especially for under age users (Goldenberg et
01.,2012). Owing to the fact that both sex work and drug use are illegal, sex workers who
use drugs are more vulnerable to police harassment like frequent arbitrary arrests or
police misconduct like extortion and blackmail. They also face the risk of physical as
well as sexual abuse which increases the odds of HlV acquisition and reduced probability
of seeking medical attention (Cottler et 01.,2014; Odinokova et aI., 2014).
Although heroin was the most common drug, a vast majority of IDUs utilized more than
one substance. In addition, consumption of khat, cocktail or alcohol and poly substance
117
use was predictive of HIV infection. While many IDUs in this study used heroin, a
depressant that tends to inhibit libido, especially in large quantities or with long-term use,
they additionally consumed stimulant-type drugs such as khat, bhang and cocktail that
increased sexual desire (Blum et al., 2013, Tadesse et al., 2013; Berhanu et al,. 2014).
4.4 Nutritional Measures of the PWID in Mombasa County
Nutritional analyses showed that body height was significantly higher among HIY-1
negative individuals compared to HIV-I positive individuals (P=O.OOl). However, body
weight, hip circumference, waist circumference, bust circumference, waist-to-hip ratio,
and bust-to-waist ratio did not differ significantly between the HIV-l negative and
positive study groups (P>0.05 for all comparisons). Although the mid-upper-arm
circumferences were significantly lower in the HIV-l positive group (P<O.OOOI), the
relative proportions of malnutrition based on MUAC definition (that is, MUAC cut-offs
of <23.0 em in males and <22.0 em in females) did not vary significantly between the
HIV-I negative and positive study groups. In addition, BMI levels and malnutrition
based on BMI<18.50 kg/m' were similar in the study groups (P>0.05 for both
comparisons). Finally, haemoglobin (Hb) levels were significantly lower in the HJV-J
positive individuals compared to the HIV-I negative groups (P=O.002). Consistent with
the low Hb levels in the HIV -1 infected group, the proportions of individuals with
anaemia was significantly higher in the HV-I positive IDUs compared to the mV-J
negative IDUs (29.3% vs. 19.2%; P=O.026) as shown in table 4.5.
118
Additional regression analyses for identifying the predictors of malnutrition (BMl<18.5
kg/nr') indicated that malnutrition in the HlV negative IDU subpopulation was
significantly associated with the CD4+ T cell count 2350<500 cells/ul. (OR, 3.718; 95%
CI, 1.264-10.932; P=O.017) and CD4+ T cells/ul. <350 cells/ul, (OR, 2.761; 95% CI,
1.204-6.334; P=0.016). Among the HIV positive IDUs malnutrition was associated with
CD4+ T cell count 2350<500 cells/ul, (OR, 2.031; 95% CI, 0.936-4.407; P=O.073) and
<350 cells/ul. (OR, 2.972; 95% CI, 1.117-7.910; P=0.029) (Table 4.7). However, HIV-l
viral loads 21,000<10,000 (OR, 1.808; 95% CI, 0.675-4.848; P=0.239);
210,000<100,000 (OR, 0.998; 95% CI, 0.394-2.526; P=0.997) and >100,000 (OR, 0.565;
95% Cl, 0.568-4.312; P=0.387) were not significantly associated with malnutrition in the
HIV positive IDUs (Table 4.6).
119
IDU
Characteristic HIV-l Negative, HIV-l Positive, p
n=214 n=157
Height, m l.71 (0.09) l.69 (0.11) 0.001
Weight, kg 54.0 (9.0) 53.0 (8.0) 0.295
Hip circumference, ern 90.0 (7.8) 90.0 (8.0) 0.381
Waist circumference, 76.0 (7.0) 75.0 (9.0) 0.122
cm
Bust circumference, ern 85.0 (7.3) 85.0 (7.0) 0.898
Waist-to-hip ratio 0.83 (0.09) 0.83 (0.08) 0.487
Bust-to-waist ratio l.12 (0.11) l.13 (0.10) 0.265
MUAC,cm 26.0 (3.0) 24.0 (2.8) <0.0001
M<23.0; F<22.0cm, n 24 (11.2) 13 (8.3)
(%) 0.385
Normal, n (%) 190 (88.8) 144 (91.7)
BMI, kg/m' 18.69 (2.77) 18.75 (2.17) 0.277
<18.5, n (%) 101 (47.2) 64 (40.8) 0.245~18.5,n (%) 113 (52.8) 93 (59.2
Haemoglobin, g/elL 12.60 (2.30) 12.30 (2.50) 0.002
Anaemia, n (%) 41 (19.2) 46 (29.3) 0.026
Table 4.5: Nutritional status of Hfv-I infected and uninfected IDDs in Mombasa
County, 2012-2013
Data are presented as medians (interquartile range, IQR) for continuous variables or
number of subjects (n) and proportions (percentages, %) for categorical variables.
Statistical analyses were conducted using the Mann Whitney U test for continuous
variables and Fisher's exact test for comparing proportions between the groups. Bl\lI:
basal metabolic index. MUAC: mid upper arm circumference. Body mass index (8MI
kg/rrr'): Non-malnourished (2:18.50) and malnourished «18.50) (FANTA, 2013). MUAC
cut-offs for malnutrition: males, <23.0 cm and females <22.0 em (UNICEF, 20] I).
Anaemia was defined using haemoglobin (Hb, g/dL) cut-offs previously established by
(WHO, 2011c) as follows: non-pregnant women (~15.00 yrs), Hb<12.0 g/dl.; and men
«~15.00 yrs), Hb <13.0 g/dL).
Since this is the first known study to assess nutritional status of PWID in Kenya, the
findings of this study were compared to results of studies carried out in the general
population in Mombasa and IDU subpopulations outside Kenya. The low height found
among the HIV infected injection drug users in comparison to HIV uninfected injection
120
drug users signify loss of body height, a common feature in people living with IllV/AIDS
(McComsey et al., 2010). Similar results were reported among PWID in Chennai, South
India showing that HlV infected injection drug users presented with lower body height
relative to the HfV uninfected injection drug users (Tang et al., 2011). In addition, the
low body heights observed in the current study also parallel previous clinical studies in
the USA among HIV infected non-drug using persons aged between 4 and 24 years as
wen as in Chinese adults showing marked reductions in body height (Jacobson et a/.,
2010; Zhang et aI., 2013b).
Although the mechanisms governing the loss in body height are poorly defined, it appears
that loss of bone mineral density underlies the low body height in the HlV infected
injection drug users. This premise is supported by previous studies showing heightened
bone mineral loss in Senegalese adults living with mY/AIDS (Cournil et al., 20] 2). It is
also possible that chronic use of protease inhibitors contribute to bone mineral loss. This
suggestion is supported by previous studies in France and Japan showing that long-term
use of protease inhibitors is associated with loss of bone mineral density in adults on anti-
retroviral treatment (Duvivier et aI., 2009; Kinai, et aI., 2014).
The lack of significant differences in the standard nutritional measures of body weight,
hip circumference, waist circumference, bust circumference, waist-to-hip ratio, bust-to-
waist ratio, and BM! between the HlV infected and uninfected injection drug users
observed in this study may be related to the fact that these measures approximate both
lean and fat body mass. These results are similar to a previous study among drug users
121
living in three US cities (Baltimore, Boston, Providence) that reported low waist
circumference in both mv infected and uninfected IDUs which was associated with low
BMI as well as low body fat (Tang et aI., 2010). These fmdings suggest a lack of
abdominal obesity that is measured as high waist circumference and waist to hip
circumference ratio in both HIV infected and uninfected IDUs (WHO, 20] lb).
However, the lower mid-upper-arm circumference (MUAC), a nutritional marker for
wasting or acute malnutrition, in the HlV infected injection drug users suggests that the
mid-arm-circumference is a better surrogate for assessing acute malnutrition in HIV
infected IDUs. This proposition is supported by previous studies among non-drug using
population of Hl V infected adults in Guinea-Bissau showing that MUAC was an
independent predictor of death while in Indian, MUAC as a marker was found to be
94.6% sensitive and 71.2% specific among adolescents (Dasgupta et al., 2010~Oliveira et
al., 2012).
The Iow haemoglobin levels and associated high rates of anaemia in the HIV infected
injection drug users is indicative of increased anaemia burden in this population.
Although anaemia appears to occur in both HlV infected and uninfected injection drug
users, it is possible that consumption of foods of low nutritive value, a common practice
among injection drug users increases the risk of developing anaemia (Hendricks et aI.,
2010; Alves et al., 2011; Saeland et al., 2011; Karajibani et al., 2012). However, the
higher frequency of anaemia in the mv infected .injection drug users is partly consistent
with NASCOP guidelines on management of opportunistic infections (NASCOP, 2012c)
122
indicating that the burden of anaemia is higher in the people living HIV IAIDS in the
country. Consistent with these results previous clinical studies in Brazil and India
showed higher rates of anaemia in the HIV infected injection drug users (Solomon et aI.,
2008; Brunetta et al., 2013).
The mechanisms driving the increased anaemia burden in the HIV infected injection drug
using people are largely undefined. This is supported by previous studies in Indonesian
HIV infected adults showing that high prevalence of chronic diseases and/or iron
deficiency is associated with increased risk of anaemia (Wisaksana et aI., 2011), and
previous studies in India, Cambodia and South Africa among HIV infected adults
illustrating that long-term use of antiretroviral drugs such as zidovudine is associated
with increased risk of anaemia (Nigam et al., 2013; Phe et al., 2013; Simbarashe et aI.,
2013). Overall, the implications of these results are that incorporation of iron
supplements in the nutritional management schedules for HIV infected IDUs wiJI reduce
the risk of anaemia and other related co-morbidities leading to improved quality of life.
In order to assess the predictors of malnutrition in both HIV infected and uninfected
IDUs, binary logistic regression was conducted as shown in table 4.6. Findings
illustrating that low CD4+ T cells counts are predictive of high rates of malnutrition in
both mv infected and uninfected IDUs indicate suppression of cell mediated immunity,
a frequent sequel of malnourished persons (Franca et al., 2009). Similar results have
been reported in injection drug using patients from Brazil and the general adult
population from Germany (Brunetta et al., 2013; Iliakis and Kressig, 2014). The low
123
CD4 count may result from malnutrition and HIV infection .driven reduction in the CD4+
T cell numbers (Shalini et al., 2012). This assertion is parallel to previous studies in
South Africa showing correlations between the CD4 cell count and BMI among adults
living with HIV/AIDS (Venter et al., 2009; Evans et al., 2013).
Overall, the present study revealed that IDUs experience high levels of malnutrition with
HlV infected IDUs suffering even higher burden of malnutrition. Malnutrition in the
injection drug using population is largely attributable to reduced dietary intake,
malabsorption and or altered metabolism. Decreased dietary intake is due to abdominal
pain, anorexia, chaotic lifestyles, depression, diarrhoea, poverty, food insecurity, mouth
sores, nausea and vomiting (Anema et 01., 2010~ Smith et 01., 2012~ Strike et al., 20]2).
Malabsorption can be linked to the Hl V-induced mucosal changes, effects of drugs on
I
absorption of specific nutrients and opportunistic gastrointestinal infections (Martins et
al., 2011; Sunguya et aI., 2011; Krawinkel, 2012). In contrast, altered metabolism is
associated with the effects of injection drugs and substance consumption (like heroin and
khat), fever or cytokine-induced increase in the basal metabolic rate, hormonal
deficiencies, increased breakdown of lean body mass, and effects of medications on
metabolism (Hendricks et al., 2010; Douglas et aI., 2011; Mineur et al., 2011; Neale et
aI., 2012; Ersche et al., 2013; Rubinstein and Low, 2013).
124
Characteristic B WaJd OR (95% CI) P-value
mv-i Uninfected IDUs
CD4+ Tcells/pL
2:500 (Ref)
2:350<500
<350
1.313
1.016
5.694
5.751
3.718 (l.264-1O.932)
2.761 (1.204-6.334)
0.017
0.016
urv-r Infected IDUs
CD4+ Tcells/pL
~500 (Ref)
~350<500
<350
Vimlload (copies/mL)
Undetectable<l,OOO (Ref)
2:1,000<10,000
~1O,OOO<lOO,OOO
>100,000
0.709 3.213 2.031 (0.936-4.407) 0.073
1.089 4.756 2.972 (1.117-7.910) 0.029
0.592 1.386 1.808 (0.675-4.848) 0.239
-0.002 0 0.998 (0.394-2.526) 0.997
0.448 0.75 1.565 (0.568-4.312) 0.387
Table 4.6: Predictors of malnutrition in Hl'v-I infected and uninfected injection
drug users in Mombasa County, 2012-2013
Data are presented as odds ratios (OR) and 95% confidence interval (Cl). Binary logistic
regression was conducted using BMI<18.5 kg/nr' (malnourished) as the dependent
variable and B~18.5 kglm2 as the reference group controlling for age and gender in
HIV negative rous and age, gender and ART use in the HIV positive roUs. The CD4+ T
cells were categorized using a combined CDC classification system and NASCOP thresh-
hold for initiating anti-retroviral therapy for HIV-infected adults and adolescents into
three groups: 1) 2:500 cells/ul.; 2) 350-499 cells/ul.; and 3) <350 cells/ul. (eDC, ]992;
NA.~COP. 2012b).
Infected IDUs in Mombasa County
4.5 The Prevalence of Pulmonary TB Infections among HIV Uninfected and
A total of 39 pulmonary TB cases were detected among the study participants with the
HJV-I infected individuals (18.5%) presenting with significantly higher rates compared
to the lllV-1 uninfected individuals (4.5%) at (P<0.0001). Sensitivity testing of the thirty
nine Mycobacterium tuberculosis isolates against anti-mycobacterial first line drugs
125
treatment demonstrated that all of the isolates were sensitive to ethambutol,
pyrazinamide, rifampicin and isoniazid. A synopsis of the pulmonary TB prevalence rate
is illustrated in table 4.7.
Characteristic HIV-l Uninfected,
n=214
HIV -1 Infected,
n=157
Tuberculosis rates
*Mycobacterium
tuberculosis sensitivity to
TB drugs
Ethambutol 10 (100.0) 29 (100.0)
Pyrazinamide 10 (100.0) 29 (100.0)
Rifampicin 10 (100.0) 29 (100.0)
Isoniazid 10 (100.0) 29 (100.0)
10 (4.7) 29 (18.5) <0.0001
Table 4.7: Tuberculosis prevalence rate among PWID in Mombasa County, 2012-
2013
Data presented are number and proportions (%) of subjects. Statistical analysis was
performed using the Fisher's exact test. *antimycobacterial sensitivities were performed
on all the TB positive cases.
The findings showing higher prevalence rates of TB in the HfV infected mus indicate
that HIV -1 infection increases the risk of TB infection. However, the presence of TB in
the mV-1 uninfected IDUs, suggests that injection drug use is also a risk factor of
acquiring TB. The results illustrating TB prevalence rates of 29% in the HIV -1 infected
IDUs from Mombasa parallels previous findings of showing a 33.9% TB prevalence
among IDUs from Chennai, India (Solomon et 01., 2008). The higher risk of TB in the
HIV-l infected IDUs is attributable to the lower CD4+ T cell counts detected in this
group. The reduced CD4+ T cells consequently cause lowered cellular immunity that is
paramount for elimination of Mycobacterium bacilli (Shalini et al., 2012). It is also·
126
likely that injection drug use which is associated with weakened cellular immunity
increase the risk ofTB infection (Deiss et al., 2009; Getahun et al., 2012).
Nevertheless, the Mycobacterium tuberculosis isolates from both groups were sensitive to
all the first line anti-TB drugs. These results deviate from findings of a previous study
which isolated MDR TB from injection drug users in Tanzania (Gupta et al., 2014). In
Kenya. the reasons underlying the continued sensitivity of anti-TB treatment in this most
at risk population may be linked to the intensive surveillance and follow-up of TB cases
in the general population by Division of Leprosy, Tuberculosis and other Lung Diseases
(MOPHS, 2010). In addition, a declining trend of TB cases as well as high sputum
conversion rate (ranging between 88% and 97%) to first line of treatment in the general
population has been reported in Kenya (Kwange and Budambula, 2010; Sitienei et aI.,
2013). However, it is also possible that severe TB cases and MDR TB among lOUs were
not obtained due to the fact that sick injection drug users are less likely to access
heaIthcare (Dutta et al., 2013).
Regression analyses to identify the predictors of TB in the HlV -1 infected and uninfected
injection drug users was carried out and presented in Tables 4.8 and 4.9 respectively.
Findings indicated that the probability of having TB infection among those presenting
with malnutrition was at least four times in both HlV-l uninfected (OR, 4.599; 95% Cl,
0.946-22.357; P> 0.059) and infected (OR, 4.077; 95% cr, 1.505-11.049; P=0.006)
injection drug users. However, additional risk factors for TB did not show significant
associations with TB infection in the Hl'V-I uninfected (cigarette smoking, alcohol
127
consumption, anaemia and CD4+ T cell status) and infected (cigarette smoking, alcohol
consumption, anaemia, CD4+ T cell and viral load status) injection drug users (P>0.05).
Results indicating a higher probability of having TB infection in both HIV -1 infected and
uninfected IDUs presenting with lower BMI «18.5 kg/nr') indicate that malnutrition is
an important risk factors for TB infection in this key population. This finding is similar
to previous studies showing in the Kenyan general population low BMI was common
among TB patients (Sitienei et al., 2014). Malnutrition is associated with depressed
cellular immunity (lowering host defense against tuberculosis) and this could be
responsible for the acquisition of Mycobacterium tuberculosis, an intra-cellullar pathogen
(Drake, 2010; Duggal et al., 2012; Padmanesan et al, 2013). Among HlV-I infected
IDUs, malnutrition and reduced CD4+ T cells concomitantly worsen cellular immune
responses increasing the risk of acquiring and developing disease against intra-cellular
pathogens such asMycobacterium tuberculosis.
This study demonstrated that pulmonary TB is an important problem in the IDU sub-
population in Mombasa. In this, key population, TB is associated with HlV and
malnutrition which are also a common burden in IDUs (Hendricks et aI., 2010; Tang et
al.• 20ll). Without adequate. control of the TB-illV syndemic, the long-term TB
elimination target set for 2050 may not be reached.
128
Characteristic pB Wald OR (95% en
Mablutritioll
B~18.5 kg/nr' (Ref)
BMI<18.5 kg/nr'
Smoking
No (Ref)
Yes
Alcohol
No (Ref)
Yes
Anaemia
No (Ref)
Yes
CD4+ TcelTs (xJ(fjpL)
2:500 (Ref)
2:350<500
<350
1.526
0.072
0.203
0.732
0.180
1.222
3.527
0.011
0.057
0.890
0.027
0.920
4.599 (0.946-22.357)
1.075 (0.275-4.200)
0.816 (0.155-4.297)
2.079 (0.455-9.505)
1.197 (0.138-10.383)
3.395 (0.279-41.245)
0.059
0.917
0.8\1
0.345
0.870
0.337
Table 4.8: Predictors of tuberculosis among HIV-l uninfected IDUs in Mombasa
County,2012-2013
Data are presented as odds ratios (OR) and 95% confidence interval (Cl). Binary logistic
regression analysis was conducted by entering tuberculosis status as the dependent
variable, risk factors (malnutrition, smoking, alcohol, anaemia, and CD4+ T cells) as
independent variables, and controlling for age and gender. Ref, reference. BMI, basal
metabolic index. .
129
Characteristic B Wald OR (95% CI) p
Malnutritioll
BMI218.5 kg/m' (Ref)
BMI<18.5 kg/m'
Smoking
No (Ref)
Yes
Alcohol
No (Ref)
Yes
Anaemia
No (Ref)
Yes
CD4+ T cells (xJ(f /J1l)
2:500 (Ref)
~350<500
<350
Viralload/mL
Undetectable<l,OOO
(Ref)
2:1,000<10,000 1.002 1.899 2.724 (0.655-11.329) 0.168
2:10,000<100,000 1.009 2.383 2.742 (0.762-9.869) 0.123
>100,000 0.784 l.216 2.190 (0.544-8.828) 0.270
Table 4.9: Predictors of tuberculosis among HIV~l infected PWID in Mombasa
County,2012-2013
1.405 7.634 0.0064.077 (1.505-11.049)
0.027 1.027 (0.375-2.815) 0.9590.003
0.803 2.231 (0.697-7.141) 0.1761.827
0.292 0.328 0.5671.340 (0.492-3.646)
0.655
0.927
0.248
0.180
1.334
1.801
1.924 (0.634-5.843)
2.526 (0.653-9.779)
Data are presented as odds ratios (OR) and 95% confidence interval (Cl). Binary logistic
regression analysis was conducted by entering tuberculosis status as the dependent
variable, risk factors (malnutrition, smoking, alcohol, anaemia, and CD4+ T cells) as
independent variables, and controlling for age and gender. Ref, reference. BMI, basal
metabolic index.
4.6 The HIV Subtypes that Cause HIV Infections in IDUs Living in Mombasa
County
Seventy six (48.4%) of the one-hundred and fifty seven HIV-J infected IDUs were
successfully' sequenced. Genotype analysis identified the following sub-types: Al
130
(56.6%), C (15.8%), D (14.5%), A2-C (1.3%), ABDU (1.3%), B (1.3%) and G (1.3%) as
illustrated in Table 4.10.
Subtype Male Female Total
Al 18(58.1) 25 (55.6) 43 (56.6)
C 9 (20.0) 3 (9.7) 12 (15.8)
D 7 (15.6) 4 (12.9) 11 (14.5)
A2 AG 2 (6.5) 2(4.4) 4 (5.3)
AJD I (3.2) 1 (3.2) 2 (2.6)
AlC 0(0.0) 1 (3.2) 1 (1.3)
ABDU 0(0.0) 1 (3.2) 1 (1.3)
B 0(0.0) 1 (3.2) 1 (1.3)
G 1 (2.2) 0(0.0) 1 (1.3)
Table 4.10: HIV-l subtypes circulating in IDUs from Mombasa County. 2012-2013
Data presented are number and proportions (%) of participants. Note: A2_AG, A1D,
A2C and ABDU are circulating recombinants forms (CRFs).
The high prevalence of subtype Al detected in the IIIV-1 infected injection drug users
signifies the dominance of this subtype transmission within the injection drug users from
Mombasa, Although subtype Al was the most frequent, the rate was lower relative to
previous cross-sectional studies in Mombasa (same area as the present study) showing
89.7% prevalence in anti-retroviral treatment-exposed injection drug users (Osman et al.,
20U) and 70.6% prevalence among anti-retroviral treatment-naive individuals from the
general population (Sigaloff et al., 2012). This evident variation in the prevalence of the
Al sub-type between the current study and previous studies from the same study area
may be attributable to the rapidly evolving epidemiology of HIV -1 subtypes in this most-
at-risk-population that is frequently exposed to multiple subtypes.
131
This fact is related to the high rates of C, D and circulating recombinant forms detected in
the present study compared to the previous studies in the same study area. Based on
review of studies carried out in different regions in Kenya on HIV sub-types (Kageha et
al., 2012; Khamadi et aI., 2009; Kiptoo et aI., 2013; Lihana et aI., 2009; Muriuki, 2012;
Nyamache et al., 2013; Osman et al., 2013; Sigaloff et al., 2012), the present study is the
first to report the presence of sub-type B in the country. This further supports the
preposition that there is changing epidemiology of circulating HIV -1 subtypes in Kenya.
132
CHAPTER FIVE: CONCLUSION AND RECOMMENDATIONS
5.1 Conclusion.
From the study, it was hypothesized that social-demographic characteristics are similar
between HlV infected and uninfected IDUs. However the study findings imply that the
female gender, being separated or divorced, widowhood, early sex debut, sex work,
working in entertainment and beauty therapy sectors, exposure to STr and risky sexual
practices were statistically more significant in the HlV infected group than uninfected
IDUs. Therefore the null hypothesis is rejected and it is concluded that social-
demographic characteristics vary between Hl V infected and non-infected IDUs.
Longer duration of injection use, needle and syringe sharing, injecting heroin or cocaine
in addition to using alcohol, khat, and cocktail as well as polydrug use increased the risk
of exposure to HlV, The null hypothesis that proposed drug use patterns are invariable
between HlV infected and uninfected IDUs is rejected and the researcher concludes drug
use patterns differ between Hl V infected and uninfected IDUs.
Although low anthropometric measurements and aneamia were common in the IDUs
irrespective of their HIV status, the HIV infected IDUs fared worse than the uninfected.
The null hypothesis that had proposed stating that the nutritional status was
incomparable between HIV infected and non-infected IDUs is accepted. Based on the
findings it is concluded that in terms of nutrition, the mv positive injection drug users
are more malnourished than the infected IDUs.
133
The significant high .proportions of TB in 'HlV positive in comparison to the negative
IDUs imply that HIV infected IDUs are at an elevated risk of acquiring TB infections.
The null hypothesis is rejected and based on findings of the study it is concluded that TB
infection rate do vary with mv infection in the IDU subpopulation.
The assortment of HIV -1 subtypes and recombinants that co-circulate among PWID in
Mombasa courtesy of high risk injecting and sexual practices point to the changing
epidemiology of circulating HIV-i subtypes in Kenya. The proposed hypothesis is
rejected and supported by the findings of this present study, it is concluded t~1atan array
ofHIV-l sub-types and recombinants co-circulate in IDUs in Mombasa County.
Overall, the study demonstrated multiple trajectories of drug injection behaviours. By
understanding socio-economic factors, drug use patterns, nutritional status, TB as well as
HIV trends among users in this subpopulation forms the basis of preventive and
therapeutic interventions.
-
5.2 Recommendations
From this study, empowerment of youths and women is recommended through the
Ministry of Labour, Social Security and Services. Although the national government has
already set aside funds to benefit the youths and women, the most vulnerable categories
like those who dropped out of primary and secondary schools are yet to benefit.
Empowerment is crucial as this will curtail idleness, drug abuse and high risk sexual
behaviour. In addition both public and private funded rehabilitation centres ought to
134
integrate vocational training skills in their rehabilitation packages so as rehabilitated
IDUs are empowered in order to prevent reversion to drug use, idleness and high risk
sexual behaviour.
The County government, non-governmental organizations (NGOs), community and faith
based organizations (CBOs and FBOs respectively) should plan for targeted activities
that will aim at educating sex workers. In addition, they should be empowered to
venture into alternative income generating activities.
Given that female IDUs are vulnerable to HIV infections; it is recommended that the
County government of Mombasa to design female friendly IDU services as currently
none of the public funded rehabilitation centres admit female clients. In view of the fact
that female exposure to HIV has a direct implication on mother to child HIV
transmission, there is need to put in place appropriate interventions targeting FIDUs.
The NGOs, CBOs and FBOs in Mombasa, should upscale targeted programmes that
promote family unit as it moderates the probability of one engaging in drugs as well as
high risk sexual behaviour.
The County government should invest in friendly drop-in centres for IDUs, non rDUs
and their partners in order ensure accessible compressive primary health care services
(PHC). In addition, integrated approaches are required in advocating for behaviour
135
change and early diagnosis as well as treatment of STIs in order to curb the high H1V
rates among the mus and their sexual partners by extension.
The Nationa Authority for the Campaign against Alcohol and drugs in conjunction with
Mombasa based NGOs and CBOs should start monitoring drug use patterns. For
example, seasons when drugs are consumed most, type of drug( s) taken, polydrug use as
well as mode of administration. This will help in developing targeted interventions like
integrating prevention of alcohol, cocktail and khat consumption in injection drug use
and mv intervention programs.
In addition the Pharmacy and Poisons Board should flex its muscles and withdraw
licenses or black list the pharmacy operators who dispense prescription drugs Rohypnol
and valium on over the counter basis.
Overall to moderate drug use, the National government ought to step up the war against
drugs by targeting the drug supply chain starting with the barons, distributors and
peddlers so as to reduce supply of drugs in the market. In accordance with the law of
supply and demand, reduced supply will lead to increase in drug prices and fear of being
arrested hence reduced demand.
Since malnutrition is an important correlate of the Immune status of PWID, it is
recommended to Ministry of Health (MaR) to facilitate food assistance and.
micronutrient supplementation programmes as well as nutritional education to roUs in
136
order to improve their nutritional status and immunological outcomes, especially, among
themv infected IDUs as an adjunct for the antiretroviral therapy regimens.
It is recommended to the County of government to integrate active TB screening into
drug prevention and management programmes as well as in targeted outreach activities.
These services should work in close tandem with the MOR in order to facilitate early
diagnosis and effective treatment of TB among injecting drug users. This will also help
in the achievement of MDG 6C and MDG 1C that seeks to halt the TB burden as well as
reduce by half the proportion of population below minimum level of dietary energy
consumption respectively.
'In addition, continued surveillance for MDR-TB by the MOR ought to be up scaled to
reach the hidden subpopulations like roUs that are unlikely to utilize PHC services.
To both the National and County governments, the up-scale HIV education is
recommended in order to reduce infection and re-infection rates within the IDU sub-
population as well as the general population. This will contribute greatly towards
achieving MDG 7 that calls for the halting and reversing of the spread ofHIV/AIDS and
the achievement of universal access to treatment for RIV/AIDS.
As part of way forward, it is recommended that the National government, research
stations and independent researchers to work together in continuous surveillance of tile
HIVepidemiology .
137
5.3 General recommendations
The researcher recommends health education to the public that should be initiated and
facilitated by both National and County governments. This can be achieved through
substance and drug abuse awareness starting at an early age for example at primary
school level. Such an approach can form the basis of responding to substance use before
one starts using substances. In addition, this strategy could help to discourage or stop use
in those who are already experimenting or using. Such programmes can be extended to
proprietors and workers of entertainment venues as well as beauty parlours. Substance
and drug abuse awareness will help in reducing demand for drugs which in return will
lead to supply reduction.
Additionally, it is imperative for police education programs to be designed in order to
align policing with public health efforts targeting vulnerable populations (MARPS). This
will minimize incidents of sex for police protection as well as arbitrary arrests from law
enforcers since fear of arrest drives PWID away from HlV testing and primary
healthcare services. Moreover it disrupts antiretroviral therapy resulting in elevated illV
viral load and subsequent IllV trans-mission as well as increased antiretroviral
resistance.
Other state actors like lawmakers (including but not limited to Members of Parliament
and Members of County Assemblies) and criminal justice authorities (like magistrates
and judges) should also be provided with educational programs on human rights and
public health interventions.
138
Both the County and National government are advised to support harm reduction
interventions by developing policy and guidelines on harm reduction at the same time
implementing them. These interventions may include counseling, syringe and needle
exchange programmes (SNEP), methadone assisted treatment (MAT) and provision of
safe injecting facilities (SIF).
The County government is advised not to ignore the plight of PWID or persecute them
through arbitrary arrests but instead facilitate their voluntary rehabilitation. This can be
achieved through partnership with NGOs, CBOs, and FBOs as well as the private sector.
Additionally, the community and affected families need to be encouraged to accept back
the rehabilitated IDUs. This will help to break the vicious cycle of rejection and stigma
associated with IDU.
As a parting to all the parties mentioned in these recommendations, people who use drugs
have the same human rights as people who have never used drugs. These rights include
the right to the highest attainable standard of health, to social services, to work, to
freedom from arbitrary detention and freedom from cruel inhuman as well as degrading
treatment. A time has come for all mankind to stop focusing on the sin but what happens
to the sinner.
-
J\TTAUN V R ITY-LI RA ~;
-~-. - •. e _ .••--:--:--'
139
5.4 Suggested Further Research
Since this was a cross sectional study no causal relationships could be established.
Therefore further research needs to be carried out using a longitudinal and experimental
approach. There is a possibility that drug use pattern was not well captured due to the
structure of the interview schedule. In future studies it is advisable an elaborate list of
drugs should be included so that the participants can respond to the items on the list. In
addition, both drug use patterns and exposure to STIs were self-reported and hence may
be confounded by recall bias. Future studies should include toxicological analysis of
urine in order to a certain the complete set of injecting and non-injecting drugs used by
the study participants. Moreover, future studies should include comparative groups like
non-injecting drug users and non drug users.
Although both MUAC and BMJ are good nutritional markers, it is imperative that
additional nutritional markers like biochemical, body composition measurements and
dietary intake assessment be examined. It is suggested further research be carried out on
TB and HIV epidemiological patterns in both high risk as well as general population.
While the present study has shed light on predictors of HlV and Pulmonary TB among
PWID, more studies need to be carried out to reinforce or refute the findings of this
study.
140
REFERENCES
Abdala N, White E, Toussova OV, Krasnoselskikh TV, Verevochkin S, Kozlov AP and
Heimer R. (2010). Comparing sexual risks and patterns of alcohol and drug use
between injection drug users (IDUs) and non-IDUs who report sexual partnerships with
lDUs in St. Petersburg, Russia. BMC Public Health, 10:676.
Abecasis AB, Annemarie MW, Dimitris P, Jurgen V, Kristof T, David AV, Albert J ,
Asjo B, Balotta C, Beshkov D, Camacho RJ, Clotet B, De Gascun C, Griskevicius A,
Grossman Z, Hamouda 0, Horban A, Kolupajeva T, Korn K, Kostrikis GL, Kucherer C,
Liitsola K, Linka M, Nielsen C, Otelea D, Paredes R, Poljak M, Puchhammer-Stock E,
Schmit JC, Sonnerborg A, Stanekova D, Stanojevic M, Struck D, Boucher CAB and
Vandamme AM (2013). HIV-l subtype distribution and its demographic determinants in
newly diagnosed patients in Europe suggest highly compartmentalized epidemics.
Retrovirology, 10 (7).
Abel WD, Sewell C and Eldemire-Shearer D (2011). Decriminalization of marijuana: is
this a realistic public mental health policy for Jamaica? West Indian Medical Journal,
60(3).
Ademola LA, Omoregie PI and Edoni ER (2014). Sexual Practices of Female Sex
Workers Who Inject Drugs in Osogbo, Nigeria. International Scholarly Research
Notices, 2014(2014). '.
Adermark L, Soderpalm B and Burkhardt 1M (2014). Brain region specific modulation of
ethanol-induced depression of GABAergic neurons in the brain reward system by the
nicotine receptor antagonist mecamylamine. Alcohol, 48(5):455-461. .
Ajao KO, Ojofeitimi EO, Adebayo AA, Fatusi AO and Afolabi OT (2010). Influence of
Family Size, Household Food Security Status, and Child Care Practices on the Nutritional
Status of Under-five Children in Ile-Ife, Nigeria. African Journal of Reproductive Health,
14(4): 123-132.
Akiibinu MO, Adekunle M and Ayodele 00 (2012). Micronutrients and Markers of
Oxidative Stress in Symptomatic HIV-Positive/AIDS Nigerians: A Call For Adjuvant
Micronutrient Therapy, 3(2): 7-11.
Alcantara KC, Reis MNG, Cardoso LPV, Bello G and Stefani MMA (2013). Increasing
heterosexual transmission of HIV -1 subtype C in Inland Central. Western Brazilian
Journal of Medical Virology, 85: 396-404.
Alkiviadis GN, Andrea JL and Maria MO (2010). Syringe Exchange Programs: Impact
on Injection Drug Users and the Role of the Pharmacist from a U.S. Perspective. Journal
of American Pharmacists Association, 50(2): 148-157.
141
Almeida EM, Rubia M, Dennis MJ, Tiago G, Caroline PB, Gonzalo B, Morgado MG and
Guimaraes ML (20l2). Temporal dynamics of HIV-l circulating subtypes in distinct
exposure categories in southern Brazil. Virology Journal, 9:306.
Alves D, Costa AF, Custodio D, Natario L, Ferro-Lebres V and Andrade F(201!).
Housing and employment situation, body mass index and dietary habits of heroin addicts
in methadone maintenance treatment. Association jar the Application of Neuroscientific
Knowledge to Social Aims, 13(1):1592-1638.
Al-Wadei H., Al-Wadei MH and Schuller HM (2012). Cooperative Regulation of Non-
Small Cell Lung Carcinoma by Nicotinic and Beta-Adrenergic Receptors: A Novel
Target for Intervention. PLoS ONE, 7(1).
Amoako AA, Marczylo TH, Marczylo EL, Elson J, Willets 1M,Taylor AH and Konje JC
(2013). Anandamide modulates human sperm motility: implications for men with
asthenozoospermia and oligoasthenoteratozoospermia. Journal of Human Reproductive
Sciences, 28(8):2058-2066
Andrade J and Gin KG (2009). Alcohol and the heart. Issue: British Columbia Medical
Journal, 51(5): 200-205.
Amomkul PN, Vandenhoudt H, Nasokho P, Odhiambo F, Mwaengo D, Hightower A, .
Buve A, Misore A,Vulule J, Vitek C, Glynn J, Greenberg A, Slutsker L, De Cock KM
(2009). HIV Prevalence and Associated Risk Factors among Individuals Aged 13.-.34
Years in Rural Western Kenya. PLoS ONE 4(7)
Andrade CS, Jesus RP, Andrade TB, Oliveira NS, Nabity SA, Ribeiro GS (2012).
Prevalence and Characteristics Associated with Malnutrition at Hospitalization among
Patients with Acquired Immunodeficiency Syndrome in Brazil. PLoS ONE, 7(11)
Andrade LF, Carroll KM and Petry NM (2013). Marijuana use is associated with risky
sexual behaviours in treatment-seeking polysubstance abusers. American Journal of Drug
Alcohol Abuse, 39(4):266-271.
Andreasen MF, Christian L and Elisabet K (2009). Adulterants and Diluents in Heroin,
Amphetamine, and Cocaine Found on the Illicit Drug Market in Aarhus, Denmark. The
Open Forensic Science Journal, 2:16-20.
Anema A, Wood E, Weiser SD, Qi J, Montaner JS and Kerr T (2010). Hunger and
associated harms among injection drug users in an urban Canadian setting. Substance
Abuse Treatment and Prevention Policy, 5:20. .
Association of Public Healt Laboratories,' (2009). AFB Smear Microscopy.
httpJ/www.aphl.org/aphlprograms/infectious/tuberculosisrrBCoreCurriculum/Document
sfTBAFBSmearMicroscopyTrainerNotes\. pdf
142
Atkinson J, McCurdy S, Williams M, Mbwambo J and Kilonzo G (2011). mv risk
behaviours, perceived severity of drug use problems, and prior treatment experience in a
sample of young heroin injectors in Dar es Salaam, Tanzania. African Journal of Drug
Alcohol Studies, 10:1-9.
Ayenew F, Tadesse T and Azale T (2012). Alcohol and khat use as risk factors for HlV
infection among visitors to voluntary counselling and testing centres in Northwest
Ethiopia. Tropical Doctor, 42:99-100.
Baddeley A. (2013). Measuring TB burden and access to TB services for people who
inject drugs in the WHO European Region, 2010 and 20] 1.
http://www.ihra.net!files/2013/091l3/Annabel Baddeley - 714.pdf.
Badiye A and Mansi G (2012). A Review on Abuse as Date Rape Drug. Helix, 3:161-]64
Bang-Ping J (2009). Sexual dysfunction in men who abuse illicit drugs: a preliminary
report. Journal of Sexual Medicine, 6(4):1072-1080.
Bad M, Battista N, Pirazzi V and Maccarrone M (2011).The manifold actions of
endocannabinoids on female and male reproductive events. Frontiers in Bioscience,
1(16):498-516.
Barth PR. (2009). Preventing Child Abuse and Neglect with Parent Training: Evidence
and Opportunities. Preventing Child Maltreatment, 19 (2).
BAT (2010). History of tobacco in Africa. Accessed on 2nd July 20] 4 via
http://www.bat!careers.com/grouphr/ siteslBA T 8VEHSC .nsf/vwPages WebLiveID08 VF
CLL?opendocument&SKN= 1
Beckerleg S, Telfer M and Sadiq A. (2006). A Rapid Assessment of Heroin use in
Mombasa, Kenya. Substance Use and Misuse, 41(6-7): 1029-1044.
Beckerleg, S (2004). How cool is heroin use at the Kenyan Coast? Journal of Drugs,
Education and Policy. 3:159-169.
Beckerleg, S and Hundt, GL (2004). The characteristics and recent growth of heroin
injecting in a Kenyan coastal town. Addiction Research and Theory, 12(1): 41-53.
Bergstrom, J (2002). From The Beginning: The Chronology of Heroin Use
ht1p:llwww.mapinc.org/drugnews/v02/n2154/a08.html
Berhanu M, Aregash E and Alyi M (2014). Socio-Economic Impact of Khat in Mana
District, Jimma Zone, South Westem Ethiopia. Discourse Journal of Agriculture and
Food Sciences, 2(2): 21-32.
143
Bezemer Dl, Faria NR, Hassan A, Hamers RL, Mutua G, Anzala 0, Mandaliya K,Cane
p. Berkley JA, Rinke de Wit TF, Wallis C, Graham SM, Price MA, Coutinho RA,
Sanders EJ (2014). mv Type 1 transmission networks among men having sex with men
and heterosexuals in Kenya. AIDS Research and Human Retroviruses, 30(2): 118-126.
Birech J, Kabiru J, Misaro J and Kariuki D (2013). Alcohol Abuse and the Family: A
Case Study of the Nandi Community of Kenya. International Journal of Humanities and
Social Science. 3 (15).
Blaylock BL, Gould RW, Banala A, Grundt P, Luedtke RR, Newman AH and Nader MA
(201]). Influence of cocaine history on the behavioural effects of dopamine D3 receptor-
selective compounds in monkeys. Neuropsychopharmacology, 36: 1104-1113.
Blaylock BL and Michael AN (2012). Dopamine D3 Receptor Function and Cocaine
Exposure. Neuropsychopharmacology Reviews, 37: 297-298.
Blum J, Hana G, Urs G, Otto S, Sylvie P, Anita R, Gerhard AW, Stefan JB and Walter M
(2013). Acute effects of heroin on emotions in heroin-dependent patients. The American
Journal on Addictions, 22 (6): 598-604.
Bogenschutz MP, Samara LR, Tonigan JS, Vogel HS, Nowinski J, Hume D and Arenella
PB (2014). 12-step facilitation for the dually diagnosed: A randomized clinical trial.
Journal of Substance Abuse Treatment, 46 (4): 403-411.
Bomu Hospital (2013). Accessed
http://www .mkomani. orglbranches.htrnl.
on April 2014 'via
Bonsor K and Nicholas G (2011). How Marijuana Works. Accessed on 19th April 2014
via http://science.howstllffworks.comlmarij uana.htm>.
Borio, G (2010). The History of Tobacco Part I. Accessed on 12th April 2014 vta
http://www.historian.orglbysubject/tobaccol.htm.
Botany.com. (2014). Plant Encyclopedia to Identify Plants, Flowers, Trees & More.
Accessed on 3n1 April2013 via http://www.botany.com/indexl.html.
Bowring AL, Luhmann N, Pont S, Debaulieu C, Derozier S, Asouab F, Toufik A,van
Gemerta C, Dietzea P and Stoove M (2013). An urgent need to scale-up injecting drug
harm reduction services in Tanzania: prevalence' of blood-borne viruses among drug
users ill Temeke District, Dar-es-Salaam.lnternational Journal o.f Drug Policy, 24( 1):78-
81.
Braithwaite RS, Nucifora KA, Kessler J, Toohey C, Mentor SM, Dhler LM, Roberts MS
and Bryant K (2014). Impact of Interventions Targeting Unhealthy Alcohol Use in Kenya
144
on HIV Transmission and AIDS-Related Deaths. Alcoholism: Clinical and Experimental
Research, 38: 1059-1067.
Braun TP ann Daniel LM (2010). Pathophysiology and treatment of inflammatory
anorexia in chronic disease. Journal of Cachexia Sarcopenia Muscle, 1(2):l35-145.
Bredholt T, Ersveer E, Erikstein BS, Sulen A, Reikvam H, Aarstad ill, Johannessen AN,
Vintermyr OH, Bmsemd (2) and Gjertsen BT(2013). Distinct single cell signal
transduction signatures in leukocyte subsets stimulated with khat extract, amphetamine-
like cathinone, cathine or norephedrine. BMC Pharmacology and Toxicology, 14:35.
Brenneisen R, Fisch HU, Koelbing D, Geisshusler S and Kalix P (2012). Amphetamine-
like effects in hwnans of the khat alkaloid Cathinone. British Journal of Clinical
Pharmacology, 211(2): 144-149
Brodish P, Kavita S, Rinyuri A, Njeru C, Kingola N, Mureithi P, Sambisa W and Weir S
(2011). Evidence of high-risk sexual behaviours among injection drug users in the Kenya
PLACE Study. Drug and Alcohol Dependence, 119(1-2): 138-141.
Brown HL and Graves CR (2013). Smoking and marijuana use in pregnancy. Clinical
Obstetrics Gynecology, 56(1):107-113.
Brunetta DM, De Santis, Vilar GC, Fernando C, Brandao RA, Muniz RZA, de Lima
GMN. Amorelli-Chacelb ME, Covas DT and Machado AA (2013). Hematological
particularities and co-infections in injected drug users with AIDS. Brazilian Jou17101of
Infectious Diseases, 17(6): 654-656.
CAMH, (2010). Addiction Centre for Addiction and Mental Health. Accessed on zs"
April 2014 via http://www.camh.ca/en/hospital/health _information/a _z_mental_health _
and~addiction _informationldrug-use-addictionIPages/addictiou.aspx.
Camila P, Pereira da Silva Marchini AM, Barbara MAM, Reis de Vasconcellos LM
Fernandes da Rocha R and Marchini L (2011). Negative Effects of Alcohol Intake and
Estrogen Deficiency Combination on Osseointegration in a Rat Model. Journal of Oral
Imp/ontology, 37(6): 633-639.
Campaign for Tobacco Free Kids, 2013. Golden Leaf, Barren Harvest: The Costs of
Tobacco Farming. Accessed on 12th April 2014 via
http://www.ash.org.uk/files/documents/ASH 330.pdf..
Carias A, McRaven M, Anderson M, Henning T, Kersh E, Smith J, Butler K,
Vishwanathan S, McNicholl 1M, Hendry RM, Veazey R and Hope T (2012)_ HlV
interactions and the perils of epithelial thinning in the female reproductive tract.
Retrovirology , 9(2): 363.
145
Castells X, Casas M, Perez-Mafia C, Roncero C, Vidal X and Capella D (2010). Efficacy
of psychostimulant drugs for cocaine dependence. Cochrane Database of Systematic
Reviews, 17(2).
Cavlek VT, Jelena M, Ljiljana K and Branko K (2011). Hepatitis C Virus Antibody
Status, Sociodemographic Characteristics, and Risk Behaviour among Injecting Drug
Users in Croatia. Central European Journal of Public Health, 19 (1): 26-29
Cayla JA, Rodrigo T, Juan R, Jose AC, Rafael V, Jose MG, Rafael B, Marti C and the
Working Group on Completion of Tuberculosis Treatment in Spain (Study
ECUTTE).(2009). Tuberculosis treatment adherence and fatality in Spain. Respiratory
Research, 10:121
eDC, (1992). Centers for Disease Control and Prevention. 1992 revised classification
system for HfV infection and expanded surveillance case definition for AIDS among
adolescents and adults. Morbidity and Mortality Weekly Report, 18 (41):1-19.
CDC, (2009). Anthropometry Procedures Manual, National Health and Nutritional
Examination Survey. Accessed on 18th July 2014 via http://www.cdc.gov/nchs/data I
nhanes/nhanes 09 101B0dyMeasures 09.pdf.
CDC, (2010). Centers for Disease Control and Prevention. The Role of STD Detection
and Treatment in HfV Prevention - CDC Fact Sheet. Accessed on 29th April 20]4 via
lmp:Uwww.cdc.gov/stdlhiv/stdfact-std-hiv.htm.
CDC, (201] a). mv Testing and Treatment mmong Tuberculosis Patients in Kenya,
2006-2009. Morbidity and Mortality Weekly Report. 59(46);1514-1517.
CDC, (201lb). Tetanus surveillance. Morbidity and Mortality Weekly Report.
60(1.2):365-369.
CDC, (2012a). Multidrug Resistant Tuberculosis. Accessed on 8th April 2014 via
http://www.cdc.gov/tb/publications/factsheets/drtb/mdrtb.htrn.
CDC, (2012b). National Center for mY/AIDS, Viral Hepatitis, STD, and TB Prevention,
Division of STD Prevention. Accessed on 10th January 2013 via
http://www .cdc.gov/nchhstp/about.htrn.
CDC, (2012c). Hl V Infection and HlV-Associated Behaviours Among Injecting Drug
Users - 20 Cities, United States, 2009. Morbidity and Mortality Weekly Report,
61(08); 133-138.
CDC, (2012d). Integrated Prevention Services for mv Infection, Viral Hepatitis,
Sexually Transmitted Diseases, and Tuberculosis for Persons Who Use Drugs Illicitly:
146
CDC, (20 12e). Hepatitis C Information for the Public. Accessed on 21st August 2013 via
http://vvww.cdc.gov/hepatitis/c/cfag.htm.
CDC, (2012f). Tuberculosis. Accessed on 6th June 2012 via http://www.cdc.gov/tb/
topiclbasics/default.htm.
Summary Guidance from CDC and the U.S. Department of Health and Human Services.
Morbidity and Mortality Weekly Report, 61(5): 1-46.
CDC, (2013). Health Effects of Cigarette Smoking. Accessed on 21 st August 2013 via
http://www.cdc.gov/tobacco/data statistics/fact sheets/healtheffects/effects cig smoking
CDC, (20 13b). Hepatitis B Information for the Public. Accessed on 2nd April 2014
http://www.cdc.gov/hepatitislb/.
CDC, (20 13c). Hepatitis C Information for the Public. Accessed on 2nd April 2014
http://www.cdc.gov/hepatitis/c/.
CDC, (2013d). Vaccines and Preventable Diseases: Hepatitis B Vaccination. Accessed on
2nd Apri12014.http://www.cdc.gov/vaccines/ypd-vac/hepb/ .
CDC, (20 13e). Vaccines and Preventable Diseases:Tetanus (Lockjaw) Vaccination.
Accessed on 2nd April 2014. http://www.cdc.gov/vaccines/vpd-vac/tetanus/.
CDC, (2014). Tuberculosis Data and Statistics. Accessed on 14th Jan 2014.
bttp:/Iwww.cdc.gov/tb/statisticsl.
Celentano DD, Latimore AD and Mehta SH (2008). Variations in sexual risks in drug
users: Emerging themes in a behavioural context. Current HIV IAIDS Report. 5(4): 212-
218.
Cegielski JP, Arab Land Cornoni-Huntley J (2013). Nutritional risk factors for
tuberculosis among adults in the United States, 1971-1992. American Journal of
Epidemiogy, 176(5):409-422.
CESAR, (2013). Center for Substance Abuse Research. Accessed on I" August 2013 via
http://www.cesar.wnd.edu/.
Chakraborty A, Gupta A, Singh AK and Patni P (2014). Effect of oxidative
phytochemicals on nicotine-stressed UMNSAHlDF-1 cell line. Journal of Traditional
Complementary Medicine, 4: 126-131
Chakrapani V, Newman PA, Murali S and Dubrow R (2011). Social-structural contexts
of needle and syringe sharing behaviours of Hlv-positive injecting drug users in
.Manipur, India: a mixed methods investigation. Harm Reduction Journal. 8(9).
147
Chandra K and Madison J (2012). Withdrawal Symptoms Hindering Harm-Minimization
and Drug Detoxification Efforts: Experiences of Injecting Drug Users in Nepal. Journal
of HIJl/AlDS and Social Services, 11 :3.
Chekuri V, Gerber D, Brodie A and Krishnadas R (2011). Premature ejaculation and
other sexual dysfunctions in opiate dependent men receiving methadone substitution
treatment. Addictiont Behaviour, 37(1): 124-126.
Chen H, Saad S, Sandow SL and Bertrand PP (2012). Cigarette smoking and brain
regulation of energy homeostasis. Frontiers in Pharmacology. 25(3):147. .
Chesang, KR ( 2013). Drug Abuse Among The Youth In Kenya. International Journal of
Scientific and Technology Research, 2(6).
Chweya M and Auya S (2014). Socio- Economic Effects of Alcoholism on Families in
.Mukuru Slum, Nairobi County. International Journal of Innovation and Scientific
Research, 9(1): 35-39.
Ciccarone, D (2009). Heroin in brown, black and white: Structural factors and medical
consequences in the US heroin market. International Journal of Drug Policy, 20(3): 277-
282.
Cioe PA, Anderson BJ and Stein MD (2013). Change in symptoms of erectile
dysfunction in depressed men initiating buprenorphine therapy. Journal of Substance
Abuse Treatment, 45(5):451-456.
CIRAD, (2014). Food security. Centre de cooperation internationale en recherche
agronomique pour le developpement. Accessed on 23rd/June 2014 via
http://www.cirad.fr/en/research-operations/research-topics/food-security/what-s-cirad-
doing.
Cleland CM, Des Jarlais DC, Perlis IE, Stimson G and Poznyak V (2007). HlV risk
behaviours among female IDUs in developing and transitional countries. BMC Public
Health, 7:271.
Coburn BJ, Okano JT and Blower S (2013). Current drivers and geographic patterns of
IDV in Lesotho: implications for treatment and prevention in Sub-Saharan Africa. 13MC
Medicine, 11 :224.
Cohen CR, Lingappa JR, Baeten lM, Ngayo MO, Spiegel CA, Hong T, Donnell D,
Celurn C, Kapiga S, Delany Sand Bukusi EA (2012). Bacterial Vaginosis Associated
with Increased Risk of Female-to-Male Hl v-I Transmission: A Prospective Cohort
Analysis among African Couples. PLoS Medicine, 9(6).
148
Comer DM, Joseph SE and Ennis M (2014). Inflammatory and cytotoxic effects of
acrolein, nicotine, acetylaldehyde and cigarette smoke extract on human nasal epithelial
cells. BMC Pulmonary Medicine, 14: 32.
Commonwealth of Australia (2011). The National Drug Strategy: 2010-2015: A frame
work for alcohol, tobacco and other drugs, Ministerial Council on Drug Strategy, Perth.
http://www.nationaldrugstrategy.gov.au/intemetldrugstrategy/publishing.nsf/ContentlDB
4076D49FI3309FCA257854007BAF30/$File/nds20 15.pdf.
Connor J, Psutka R, Cousins K, Gray A and Kypri K (2013). Risky Drinking, Risky Sex:
A National Study of New Zealand University Students. Alcoholism Clinical Experience
Research, 37(11):1971-1978.
Coskunpinar A, Allyson LD, Karyadi AK, Chung SK and Melissa AC (2013).
Mechanisms Underlying the Relationship between Negative Affectivity and Problematic
Alcohol Use. Journal of Experimental Psychopathology, 4 (3): 263-278.
CottIer LB, O'Leary CC, Nickel KB, Reingle 1M and Isom D (2014). Breaking the blue
wan of silence: risk factors for experiencing police sexual misconduct among female
offenders. American Journal of Public Health, 104: 338-344.
Coull AF, Atherton L, Taylor A and Watterson AE (2014). Prevalence of skin problems
and leg ulceration in a sample of young injecting drug users. Harm Reduction Journal
1l(22).
Cournil A, Eymard-Duvemay S, Diouf A, Moquet C, Coutherut J, Ngom Gueye NF,
Carnes C,- Taverne B, Bork K, Sow PS, Delaporte E and ANRS 1215 Study Group'
(2012). Reduced Quantitative Ultrasound Bone Mineral Density in Hlv-Infected Patients
on Antiretroviral Therapy in SenegaL PLoS ONE, 7(2).
Craker LE. & Zoe G.(2014). The Botany of Cannabis. Accessed on 19th April 2014 via
http://www.motherearthliving.comlnatural-healthlbotany-of-carmabis .
Crowley D, Jones DE, Coffman DL, Greenberg and MT (2014). Can We Build an
Efficient Response to the Prescription Drug Abuse Epidemic? Assessing the Cost
Effectiveness of Universal Prevention in the PROSPER Trial. Journal of Preventive
Medicine, 6:712-717.
Csete J (2010). From the Mountaintops. What the World Can Learn from Drug Policy
Change in Switzerland. Open Society Foundations, USA. ISBN: 978-1-936133-34-5.
Accessed on 25th June via http://www.opensocietvfoundations.org/sites/default
Ifileslfrom-the-mountaintops-english-20110524 O.pdf
149
Cunningham J (2012). Homelessness, Orphaned Status, IDU and Sexual Risk in HTV
Prevention, HIV/AIDS, Orphaned and Vulnerable Children and Youth, Young People
Most-at-risk ofHIV. AIDS, 26(1):111-113.
D'Alessandro AI, Boeckelmann I, Hammwhoner M and Goette A (2012) Nicotine,
cigarette smoking and cardiac arrhythmia: an overview. European Journal of Preventive
Cardiology, 19(3):297-305.
Dagne E, Yirga A, Eshetu K and Yoseph A (2010). Determination of Levels of Cathine
in Khat (Catha edulis) Leaves and its Detection in Urine of Khat Chewers: A Preliminary
Report. Ethiopian E Journalfor Research and Innovation Foresight. 2(1):7-22.
Dasgupta A, Butt A, Saha TK, Basu G, Chattopadhyay A and Mukherjee A (2010).
Assessment of malnutrition among adolescents: can BMl be replaced by MUAC? Indian
Journal Community Medicine, 35:276-279.
Davies G (2010). A Critical Evaluation of the Effects of Safe Injection Facilities. The
Journal of Global Drug Policy and Practice, 1(3).
De Vel-Palumbo M, Matthew-Simmons F, Shanahan M and Ritter A (2013)". Supervised
Injecting Facilities: What the literature tells us. Drug Policy Modelling Program Bulletin
Series, 22 (2).
DEA 2011 Drug Enforcement Administration. Accessed on io" April 20]4 VIa
http://www.usa.gov/directory/federalldrug-enforcement-administration.shtml.
-DEA Museum, 2012. Drug Enforcement Administration. Accessed on 10th April 2014
via http://www.deamuseum.orgiccplhistory.html.
DeBeck K, Kerr T, Bird L, Zhang R, Marsh D, Tyndall M, Montaner J and Wood E
(2011). Injection drug use cessation and use of North America's first medically
supervised safer injecting facility. Drug and Alcohol Dependence, 113:172-176.
Denduangboripant J, Piteekan T and Nantharat M (2010). Genetic polymorphism
between tobacco cultivar groups revealed by amplified fragment length polymorphism
analysis. Journal of Agricultural Science, 2(2): 41-48.
Deiss RG, Rodwell TC and Garfein RS (2009). Tuberculosis and illicit drug use: review
and update. Clinical Infectious Diseases, 48: 72-82.
DeSilva MB, Allen L, XuKeyi G. Zhong L, Cheng F, Mohamad B, Harrold M, Yueying
H, Gill CJ, Wubin X, Vian T, Haberer J, Bangsberg D and Sabin L (2013). Feasibility
and Acceptability of a Real-Time Adherence Device among HIV-Positive IDU Patients
in China. AIDS Research and Treatment. 2013(2013):957862
150
Deveau C, Levine Band Beckerleg S (2006). Heroin Use in Kenya and Findings from a
Community Based Outreach Programme to Reduce the Spread of HIV/AIDS. African
Journal of Drug and Alcohol Studies, 5(2): 95-106.
Di Forti M, Morgan C, Dazzan P, Pariante C, Mondelli V, Marques TR Handley R, Luzi
S, Russo M, Paparelli A, Butt A, Stilo SA, Wiffen B, Powell 1and Murray RM (2009).
High-potency cannabis and the risk of psychosis. British Journal of Psychriatry; 195:488-
91.
Dickson AJ, Shawn P, Vorce BL and Marilyn RP (2010). Multiple-Drug Toxicity
Caused by the Coadministration of 4-Methylmethcathinone (Mephedrone) and Heroin.
Journal of Analytical Toxicology. 34(3):162-168.
Dinis-Oliveira, RJ, Carvalho F, Duarte lA, Proenca JB, Santos A and Magalhaes T
(2012). 'Clinical and forensic signs related to cocaine abuse', Current Drug Abuse
Review, 5(1): 64-83.
Djoba, SJF (2014). Chlamydia trachomatis, Human Immunodeficiency. Virus (HIV)
Distribution and Sexual Behaviours across Gender and Age Group in an African Setting.
PLoS ONE, 9(3).
Douglas H, Boyle M and Lintzeris N (2011). The health impacts of khat: a qualitative
study among Somali-Australians. Medical Journal of Australia. 19;195(11-12):666-669.
Drake lV (2010). Nutrition and Immunity, Part 1. Micronutrient Information Center.
Oregon State University. http://1pi.ore gonstate. eduJss 1O/nutrition.html 21106/2013. last
updated 2010.
Drissa S, Yentema 0, Arijit N, Foro A and Brewer T (2014). What lies behind gender
inequalities in HIV/AIDS in sub-Saharan African countries: evidence from Kenya,
Lesotho and Tanzania. Health Policy Plan, 29(7):938-949.
Druginfo, (2013). Accessed on 19th May via 2014 http://www.drugabuse.gov/about-
nidalorganization.
Drugbank, (2013). Ethanol. Accessed on z= April 2014 VIa
http://www.drugbank.caldrugslD B0089 8.
Drugfree world, (2014). The Truth About Marijuana: Its Background. Accessed on 19th
April 2014 via http://www.drugfreeworJd.org/drugfacts/marijuanaiit-s-background.html.
Druglibrary, (2010). Guide to the Different Types of Hash from Around the World.
Accessed on 19th April 2014 via http://www.druglibrary.orgischaffer/.
151
Dutta A, Wirtz A, Stanciole A, Oelrichs R, Semini I, Baral S, Pretorius S, Haworth C,
Hader S, Beyrer C and Cleghorn (2013). The Global Epidemics among People Who
Inject Drugs.Washington, DC: World Bank. eISBN: 978-0-8213-9777-0.
Duvivier Cl, Kolta S, Assoumou L, Ghosn J, Rozenberg S, Murphy RL, Katlama C,
Costagliola and ANRS 121 Hippocampe study group (2009). Greater decrease in bone
mineral density with protease inhibitor regimens compared with nonnuc1eoside reverse
transcriptase inhibitor regimens in HIV-l infected naive patients. AIDS, 23(7):817-824.
ECDC, (2011). European Centre for Disease Prevention and Control and European
Monitoring Centre for Drugs and Drug Addiction. Prevention and control of infectious
diseases among people who inject drugs. Accessed on 26th April 2011 via
http://www.eurosurveillance.org/ViewArticle.aspx?Articleld=1996') .
EI Hage C, Rappeneau V, Etievant A, Morel A-L, Scama H, Zimmer L,Berod A (2011).
Enhanced Anxiety Observed in Cocaine Withdrawn Rats Is Associated with Altered
Reactivity of the Dorsomedial Prefrontal Cortex. PLoS ONE, 7(8).
ELF, (2012). European Lung Foundation, Multidrug-Resistant Tuberculosis.
http://www .europeanlung. org/en/news-and-events/news/professional- focus-christoph-
lange.
Embleton L, Ayuku D, Atwoli L, Vreeman R and Braitstein P (2012). Knowledge,
Attitudes, and Substance Use Practices Among Street Children in Western Kenya.
Substance Use and Misuse, 47(11): 1234-1247.
- Embleton L, Mwangi A, Vreeman R, Ayuku D and Braitstein P (2013). The
epidemiology of substance use among street children in resource-constrained settings: a
systematic review and meta-analysis. Addiction, 108(10):1722-1733.
EMCDDA, (2008). European Monitoring Centre for Drugs and Drug Addiction. A
cannabis reader: global issues and local experiences, Monograph series 8, Volume 2,
European Monitoring Centre for Drugs and Drug Addiction, Lisbon. Accessed on April
2014 via http://www.emcdda.europa.eu/attachements.cfinlatt 53399 EN emcdda--cannabis-mon-voI2-ch9-web.pdf.
EMCDDA, (2009). Polydrug Use: Patterns and Responses. Accessed on 21st March 2014
via http://www.emcdda.europa.eu/attachements.cfm/att 101612 EN TDAN 090
02ENC.pdf.
EMCDDA and Europol (2010). Cocaine. A European Union perspective in the global
context, EMCDDA-Europol joint publications, Publications Office of the European
Union, Luxembourg. Accessed on 6th April 2014 via http://www.emcdda.europa. eui
attachements.cfm/att 1016I2 EN TDAN09002ENC.pdf.
152
EMCDDA, (2010). European Monitoring Centre for Drugs and Drug Addiction. Trends
In Injecting Drug Use In Europe. Accessed on 1st April 2014 via http://www.emcdda:
europa.eulattachements.cfmJatt 108590 EN EMCDDA S1l0 injecting.pdf.
EMCDDA, (2010). Levamisole as a cocaine adulterant. In 2010 Annual report. Accessed
on 5th April 2014 via http://www.emcdda.europa.euJonline/annual-report/2010 /boxes /
p66.
EMCDDA, (20lla). Prevention and control of infectious diseases among people who
inject drugs. Accessed on 17th April 2014 http://ecdc.europa.eu/en/publications/
publications/Ill 012 guidance ecdc-emcdda.pdf.
EMCDDA, (201Ib). Khat. Accessed on 15th April 2014 via http://www.emcdda .europa
.en/publicationsfdrug-profilesfkhat.
EMCDDA, (2013a). Heroin. Accessed on 19th April 2014 VIa http://www.emcdda.
europa.eu/publications/drug-profiles/heroin.
EMCDDA, (2013b). Cocaine. Accessed on 18th April 2014 via http://www.erncdda.
europa.euJpublications/drug-profiles /cocaine.
EMCDDA, (20 13c). Cannabis. Accessed on 19th April 20J 4 Via
http://www.emcddaeuropa.eu/publications/drug-profiles/cannabis.
EMCDDA, (2013d). Khat. Accessed on 19th April 2014 via http://www.emcdda.
europa.eu/publications/drug-profileslkhat.
EMCDDA, (20 Be). Benzodiazepine. Accessed on 21st April 2014 Via
http://www.emcdda.europa.eu/publications/drug-profiles/benzodiazepine.
EMCDDA, (20 13f). Drug profiles. Accessed on 30th April 2014 via http://www.
emcdda. europa. eu/drug-profiles.
EMCDDA, (20 13g). Harm reduction. Accessed on 13th April 2014 via http://www.
emcdda.europa.eu/themes/harm-reduction.
Encyclopaedia Britannica, (2012). Accessed on 2nd April 2014 via http://www.
britannica.comlchecked/topic/172024/drug-use/40524/Types-of-cannabis-preparations.
Encyclopcedia Britannica Online Accessed on 30th July 2014 VIa
bttp ://www.britanni ca.comlEBchecked/media/4 7] 6/Cannabis-sativa>.
Encyclopaedia of Life, 2012. Nicotiana tabacum. Accessed on 2nd July 2014 VIa
http://eo1.org/pages/581050/hierarchy entries/50310302/overview.
153
Ersche, KD (2013). Neurobiological Correlates of the Familial Risk for Stimulant Drug
Dependence. Neuropsychopharmacology Review, 38:238-239.
Ersche KD, Jones PS, Williams GB, Turton AJ, Robbins TW and Bullmore ET (2012a).
Abnormal Brain Structure Implicated in Stimulant Drug Addiction. Science, 335: 601-
604.
Ersche KD, Turton AJ, Chamberlain SR, Miiller U, Bullmore ET and Robbins TW
(2012b). Cognitive dysfunction and anxious-impulsive personality traits are
endophenotypes for drug dependence. American Journal of Psychiatry, 169: 926-936.
Ersche KD, Bullmore ET, Craig KJ, Shabbir SS, Ulrich Muller, Suckling J, Merlo-Pich
EY, MD, and Robbins TW(2010). Influence of Compulsivity of Drug Abuse on
Dopaminergic Modulation of Attentional Bias in Stimulant Dependence. Archives of
General Psychiatry, 67(6): 632-644.
Erowid 2010. Nicotine Timeline. Accessed on 2nd July 2014 via httns:llwww.erowid.org
Ichemicals/nicotine/nicotine timeline.php.
Euromonitor, 2013. Euromonitor International Tobacco in Kenya. Accessed on 1'1 April
2014 via http://www.ellIomonitor.com/img/logo-euromonitor-international.png.
Evans D, McNamara L, Mhairi M, Selibas K, Van Amsterdam D, Baines N, Webster T
and Sann I (2013). Impact of nutritional supplementation on immune response, body
mass index and bioelectrical impedance in HIV-positive patients starting antiretroviral
therapy. Nutrition Journal 12:111
Evans P, Turner S and Trotter C (2012). The Effectiveness of Family and Relationship.
Therapy: A Review of the Literature. Melbourne: PACFA. Accessed on 28th April 2014
via www.pacfa.org.au.
FANTA, (2013). BMl and BMl-for-Age Look-Up Tables for Children and Adolescents
5-18 Years of Age and BMl Look-Up Tables for Non-Pregnant, Non-Lactating Adults >
19 Years of Age. Accessed on zs" April via http://www.fantaproiect.orgltoolslbl:ni-109k·
ltp~tables_
FAO, (2010). The state of food insecurity in the world: addressing food insecurity in
protracted crises. Accessed on 4th Nov 2013 via
bttp:l/www.fao.org/fileadmin/user uploadlagnlpdf/N-interno-rev2.pdf.
FAO, (2014). The multiple dimensions of food security. Accessed on 23rd/June 2014 via
http://www .fao.org/publications/sofi/2 0131en/.
154
Farmer S. and Hanratty B (2011). The relationship between subjective wellbeing, low
income and substance use amongst schoolchildren in the north west of England: A cross
sectional study. Journal of Public Health, 34(4):512-522. .
Fayemiwo SA, Odaibo GN, Sankale JL, Oni AA, Bakare RA, Olaleye OD and Kanki P
(2014). Diverse genetic subtypes of mY-1 among female sex workers in Ibadan,
Nigeria. African Journal of Clinical and Experimental Microbiology, 15(1)
FDA, (2009). Route of Administration. Accessed on 24~ June 2014 via
. bttp:!Iwww.fda. govlDrugslDevelopmentApprovalProcess/F ormsSubmissionRequirement
slElectronicSubmissionslDataS tandardsMan uaimonographs/ucm071667 .htm.
Feng Yl, He X, Yang Y, Chao D, Lazarus LH and Xia Y. (2012). Current research on
opioid receptor ftmction. Current Drug Targets,13(2):230-46.
Flak AL, Su S, Bertrand J, Denny CH, Kesmodel US and Cogswell :ME (2014). The
Association of Mild, Moderate, and Binge Prenatal Alcohol Exposure and Child
Neuropsychological Outcomes: A meta-analysis. Alcoholism Clinical and Experimental
Research,38(1):214-26.
Flascha Carl, (2011). On Opium: Its History, Legacy and Cultural Benefits. Prospect
Journal in Culture, History, Science and Technology. Accessed on 26th July 2013
http://prospectjoumal.org/20 11105/251on-opium- its-history-Iegacy-and-cultural-benefits/.
Floyd LJ, Hedden S, Lawson A, Salama C, Moleko AG and Latimer W (2010). The
association between poly-substance use, coping, and sex trade among black South
African substance users. Substance Use and Misuse, 45:1971-1987.
Fox AM, (2010). The·Social Determinants of my Serostatus in Sub-Saharan Africa: An
Inverse Relationship Between Poverty and Hl'V? Accessed on 4th Jan 2015 via
http://www.publichealthreports.org/issueopen.cfm?articleID=24 79.
Franca TGD, Ishikawa LLW, .Zorzella-Pezavento SFG, Chiuso-Minicucci F, da Cunha,
MLRS and Sartori A(2009). Impact of malnutrition on immunity and infection. JOUYhol
of Venomous Animals and Toxins including Tropical Diseases, 15(3): 374-390.
Fulton HG, Barrett SP, MacIsaac C and Stewart HS (2011). The relationship between
self-reported substance use and psychiatric symptoms in low-threshold methadone
maintenance treatment clients. Harm Reduction Journal, 8:18.
Gajendra KM, Jagadish M, Ramesh SP, Rajatashuvra A, Senjam GS, Akoijam SB and
Goswami P (2012). Factors associated with ever my testing among injecting drug users
(IDUs) in two my high prevalent States of India. Indian Journal of Medical Research,
136:64-71
155
Galloway GP, Buscemi R, Coyle JR, Flower K, Siegrist JD, Fiske LA, Baggott MJ, Li L,
Polcin D, Chen CYA and Mendelson J(2011). A Randomized, Placebo-Controlled Trial
of Sustained-Release Dextroamphetamine for Treatment of Methamphetamine Addiction.
Clinical Pharmacology Therapy, 89(2): 276-282.
Garduno J, Galindo-Charles L, Jimenez-Rodriguez J, Elvira G, Dagoberto T, Mihailescu
S and Hernandez-Lopez S (2012). Presynaptic (l4~2 Nicotinic Acetylcholine Receptors
Increase Glutamate Release and Serotonin Neuron Excitability in the Dorsal Raphe
Nucleus. The Journal of Neuroscience , 32(43): 15148-15157.
Gemma and Fitzgerald, 2010. Flunitrazepam: the Date Rape Drug. Accessed on 19th
Apri12014 via http://www.chm.bris.ac.uk/motm/rohypnollrohypnolh.htm.
Getahun H, Gunneberg C, Sculier D, Verster A and Raviglione M (2012). Tuberculosis
and Hl V in people who inject drugs: evidence for action for TB, HIV, prison and harm
reduction services. Current Opinion in HIV and AIDS, 7: 345-53.
Getahun W, Teferi G and Fikru T (2010). Regular Khat (Catha edulis) chewing is
associated with elevated diastolic blood pressure among adults in Butajira, Ethiopia: A
comparative study. BMC Public Health, 10:390
Gifford, S. (2012). Differences Between Outpatient and Inpatient Treatment Programs.
Accessed on 3rd May 2014 via http://psychcentraLcomilib/differences-between-
outpatient~and-inpatient-treatment-programs/0007 531.
Gibson DR, Zhang G, Cassady D, Pappas L, Mitchell J and Kegeles SM (2010).
- Effectiveness of HlV prevention social marketing with injecting drug users. American
Journal of Public Health, 100:1828-1830.
Githui, DM (2011). Drinking Culture and Alcohol Management in Kenya: An Ethical
Perspective. European Journal of Business and Management, 3(4): 1'32- 145
Global Commission on Drug Policy, (2012). The War on Drugs and HIV/AIDS. How the
Criminalization of Drug Use Fuels the Global Pandemic. Accessed on 16th May 20J4 via
http://www.globalcommissjonondmgs.org/category/news.
Government of Kenya, (2013). Kenya Food Security Steering Group (KFSSG) October
to December 2013 Short Rains Season Assessment Report. Accessed on 14th Jan 2015
via http://www.disasterriskreduction.netlfileadminluser _upload! droughtldocs/20 13-
2014%20SRA %20Report_ FinaLpdf.
Goldenberg SM, Rangel G, Vera A, Vera A, Patterson TL, Abramovitz D, Silverman JG,
Anita Raj, and Steffanie A Strathdee (2012). Exploring the impact of underage sex work
among female sex workers in two Mexico-US border cities. AIDS Behaviour, 16: 969-
81.
156
Gonzales MJ (2010). Andean Cocaine: The Making of a Global Drug (review). Journal
of Interdisciplinary History. 41(1):170-171.
Ghosh M, Rodriguez-Garcia M and Wira CR (2013). Immunobiology of genital tract
trauma: endocrine regulation of HIV acquisition in women following sexual assault or
genital tract mutilation. American Journal of Reproductive Immunology, 69 (l): 51-60.
Grant CH, Clark EA and Wong AH (2013). The intracellular progesterone receptor
regulates CD4+ T cells and T cell-dependent antibody responses. Journal of Leukocyte
.Biology, 93 :369-375.
Grebely J and Dore JG (2011). Prevention of Hepatitis C Virus in Injecting Drug Users:
A Narrow Window of Opportunity. Journal of Infectious Diseases, 203(5):571-574.
Gumbiner J (2011). History of Cannabis 111
http://chineseculture.about.comllibrary/clipartlblscliparts.htm.
Ancient China.
Gupta A, Mbwambo J and Bruce RD (2014). None Active Case Finding for Tuberculosis
among Injection Drug Users in Medication Assisted Treatment in Dar es SaJaam,
Tanzania. International Journal of Tuberculosis and Lung Diseases,18(7):793-798.
Gyarmathy VA, Neaigus A and Ujhelyi E (2009). Vulnerability to drug-related
infections and co-infections among injecting drug users in Budapest, Hungary. European
Journal of Public Health, 19(3): 260-265.
Haaland RE, Hawkins PA, Salazar-Gonzalez J, Amber J, Tichacek A, Manigart 0,
Mulenga J, Keele BF, Shaw GM, Hahn BH, Allen SA, Derdeyn CA and Hunter E (2009)".
Inflammatory Genital Infections Mitigate a Severe Genetic Bottleneck in Heterosexual
. Transmission of Subtype A and C HIV -1. PLoS Pathogens, 5(1).
Haghpanah T, Mohammadreza A and Kouros D (2010). A Review on Hematological
Factors in Opioid-Dependent People (Opium and Heroin) after the Withdrawal Period.
Journal of Addiction and Health, 2(1-2): 9-16.
Haileyesus G, Baddeley A and Ravigiione M (2013). Managing tuberculosis in people
V.1lO use and inject illicit drugs. Bulletin of the World Health Organization, 91:154-156.
Hall W and Degenhardt L(20 13). The adverse health effects of chronic cannabis use.
Drug Testing and Analysis, 6(1):39-45.
Hall AB, Coy SL, Nazarov EG and Vouros P (2012). Rapid Separation and
Characterization of Cocaine and Cocaine Cutting Agents by DifferentiaJ Mobility
Spectrometry-Mass Spectrometry. Journal of Forensic Sciences, 57: 750-756.
157
Han X, An M, Zhao B, Duan S, Yang S. Li H and Wang X (2013). High Prevalence of
HJV·l Intersubtype B9/C Recombinants among Injecting Drug Users in Dehong, China.
PLoS ONE. 8(5)
Handley ED and Chassin L (2013). Alcohol-specific parenting as a mechanism of
parental drinking and alcohol use disorder risk on adolescent alcohol use onset. Journal
of Studies on Alcohol and Drugs, 74(5):684-693.
Harrella PT, Trenza RC, Scherera M, Ropelewskia LR & Latimera WW (2012). Cigarette
smoking, illicit drug use, and routes of administration among heroin and cocaine users.
Addiction Behaviour, 37(5): 678-681.
Harte, CB (2014). Concurrent relations among cigarette smoking status, resting heart rate
variability, and erectile response. Journal of Sexual Medicine, 11(5): 1230-1239.
Hartney, E (2014). What to Expect from Heroin Withdrawal and How to Feel Better.
Accessed on 16th April 2014 via http://addictions.about.com/od/dailylifewithaddiction
/a! What- To-Expect-From-Heroin- Withdrawal.htrn.
Hashish Centre, (2013). Hashish Facts. Accessed on 19th April 2014 VIa
http://www.hashish-center.comlhashishfacts.html.
Havinga P, Van der Velden C, de Gee A and Van der Poe A (2014). Differences in
sociodemographic, drug use and health characteristics between never, former and current
injecting, problematic hard-drug users in the Netherlands. Harm Reduction Journal, 11:6.
Hays, J (2011). Opium, Morphine And Heroin And Their History. Accessed on 1st Dee
2013 via http://factsanddetails.com/world/cat54/sub348/itemI219.html.
Health Protection Agency, (2011). Accessed on 25th April 2014 VIa
http://www.hpa.org.uk/webcIHPAwebFileIHPAweb_C/1317131377664.
Hedrich D, Kerr T and Dubois-Arber F (2010). Drug consumption facilities in Europe
and beyond. In The European MonitoringCentre for Drugs and Drug Addiction.
http://www.erncdda.europa.eulattachernents.cfinlatt_l 01273_EN_emcdda-hann%2Ored-
rnon-chll-web.pdf.
Heinz AJ, Wu J, Witkiewitz K, Epstein DH and Preston KL (2009). Marriage and
relationship closeness as predictors of cocaine and heroin use. Addiction Behaviours,
34(3):258-263.
Helrnenstine AM, (2014). Rohypnol Fast Facts. Accessed on 19t11April 2014 via
bttp://chemistry.about.comlod/drugs/a/rohypnoIfacts.htm.
158
Hendricks K and Gorbach S (2009). Nutrition issues in chronic drug users living with
mv infection. Addiction Science Clinical Practice, 5:16-23.
Hendricks KM, Erzen lID, Wanke CA and Tang AM (2010). Nutrition issues in the Hlv-
infected injection drug user: findings from the nutrition for healthy living cohort. Journal
of American College of Nutrition, 29(2):136-143.
Hepatitis Foundation international (2013). Hepatitis C. Accessed on 17th April 2014 via
http://www.hepti.orgIHEPATITIS/Hepatitis-C.html
Hilber AM, Francis SC, Chersich M, Scott P, Redmond S, Bender N, Miotti Temmennan
M and Low N (2010) Intravaginal Practices, Vaginal Infections and HIV Acquisition:
Systematic Review and Meta-Analysis. PLoS ONE, 5(2).
Hirst, KK (2014). Tobacco History: Origins and Domestication of Nicotiana in Plant
Domestication. Accessed on 19th April 2014 via http://arc.haeology.about.comlodlt
erms/g I Tobacco-History.htm.
Hoffmann CJ, Mashabela F, Cohn S, Hoffmann JD, Lala S, Martinson NA and Chaisson
RE. (2014). Maternal hepatitis B and infant infection among pregnant women living with
Hl.V in South Africa. Journal of International AIDS Society, 22( 17)
Huang Y-F, Yang J-Y, Nelson KE, Kuo H-S, Lew-Ting C-Y, Chang-Hsun C, Feng-Yee
C and Hui-Rong L (2014) Changes in HIV Incidence among People Who Inject Drugs in
Taiwan following Introduction of a Harm Reduction Program: A Study of Two Cohorts.
PLoS Medicine, 11(4).
Hue S, Hassan AS, Nabwera H, Sanders EJ, Pillay D, Berkley JA and Cane PA (2012).
HfV type 1 in a rural coastal town in Kenya shows multiple introductions with many
subtypes and much recombination. AiDS Research and Human Retroviruses, 28(2):220-
224.
Hunt, R (2010). Human Immunodeficiency Virus and AIDS: Types, Sub-types and Co-
receptors. In Microbiology and Immunology Online. Accessed on 19th April 2014 via
http://pathmicro.med.sc.edu/Jechlrelhiv6.htm.
Hussong AM, Jones DJ, Stein GL, Baucom DH and Boeding S (2011). An internalizing
pathway to alcohol use and disorder. Psychology of Addictive Behaviors, 25(3):390-404.
Hwang LY, Grimes CZ, Beasley RP and Graviss EA (2009). Latent tuberculosis
infections in hard-to reach drug using population - detection, prevention and control.
Tuberculosis, 89(1):41-45.
IBM, (20]2). The International Business Machines Corporation. Accessed on 22fl(1Jan
2013 via http://www.ibm.coml.
\
159
IEBC, (2012). Constituency boundaries. Accessed on 2nd April 2014 via http://W\vw.iebc
.or. kef.
lliRA, (2010). A position statement from the International Harm Reduction Association.
Accessed on zs" April 2014 via http://www.ihra.net/files/2010/05/31IlHRA
HRStatement. pelf.
Iliakis D and Kressig RW (2014). The relationship between malnutrition and immune.
Therapeutische Umschau, 71(1):55-61.
IRIN, (2012). Integrated Regional Information Networks. KENYA: Needles to be
distributed to injecting drug users. 2012. Accessed on 2nd July 20]4 via
http://www.irinnews.org/report/95601/kenya-need1es-to-be-dlstributed-to-injecting-dmg-
users.
IRIN, (2013). HIV/AIDS: Criminalization of drug use fuelling HIV. Accessed on 2nd
July 2014 via http://www.irinnews.org/report/95746/hiv-aids-criminalization-of-dmg-
use-fuelling-hiv.
lmer TB, Teasdale WT, Tine N, Vedal S and Olofsson M (2012): Substance Use During
Pregnancy and Postnatal Outcomes, Journal of Addictive Diseases, 31: 1, 19-28.
Jacobson DL, Lindsey JC, Gordon CM, Moye J, Hardin DS et al. (20 lO). Total body and
spinal bone mineral density across Tanner stage in perinatally Hl V-infected and
uninfected children and youth in PACTG 1045. AIDS, 24(5): 687-696.
Jain B, Suneeta K, Sowmya R, Shmtika S, Vijay G and Neeraj D.(2014). Effect of peer-
led outreach activities on injecting risk behaviour among male drug users in Haryana,
India. Harm Reduction Journal, 11:3
Jones MR, Apelberg BJ, Samet JM and Navas-Acien A (2013). Smoking, Menthol
Cigarettes, and Peripheral Artery Disease in U.S. Adults. Nicotine Tobacco Research,
15(7):1183-1189.
Jung M, Leye N, Vidal N, Fargette D, Diop H, Kane CT, Gascuel 0 and Peeters M
(2012). The Origin and Evolutionary History ofHIV-1 Subtype C in Senegal. PLoS ONE,
7(3)
Junqueira DM, de Medeiros RM, Matte MCC, Arau' jo LAL and Chies JAB(20]]).
Reviewing the History ofHIV-l:Spread of Subtype B in the Americas. PLoS ONH, 6(11).
Kabbash AI, Abdul-Rahman, Shehata YA and Omar AAR. HIV infection and related risk
bebaviours among female sex workers in greater Cairo, Egypt. Eastern Mediterranean
Health Journal, 18 (9).
160
Kagaayi J, Gray RH, Whalen C, Fu P, Neuhauser D, Kigozi G, Nalugoda F, Reynolds SJ,
Maria J. Wawer and Mendel E. Singer (2014). Indices to Measure Risk of H1V
Acquisition in Rakai, Uganda. PLoS ONE, 9(4)
Kageha S, Liliana RW, Okoth V, Mwau M, Okoth FA, Songok EM, Ngaira 1M,Khamadi
SA (2012). HIV type 1 subtype surveillance in central Kenya. AIDS Research and
Human Retroviruses, 28(2):228-231.
Kahuthia-Gathu R, Okwarah P, Gakunju R and Thungu J (2013). Trends and emerging
drugs in Kenya: A case study in Mombasa and Nairobi County. Journal of Applied
Biosciences, 67:5308-5325.
Karajibani M, Montazerifar F and Shakiba M. (2012). Evaluation of Nutritional Status in
Drug Users Referred to the Center of Drug Dependency Treatment in Zahedan.
International Journal of High Risk Behaviiors and Addiction, 1(1):18-21.
Kalichrnan SC, Simbayi LC, Kagee A, Toefy Y, Jooste S and Cain D.(2006).
Associations of poverty, substance use, and mv transmission risk behaviours in three
South African communities. Social Sciences and Medicine, 62:1641-1649.
Kask K, Markina A and Podana Z (2013). The Effect of Family Factors on Intense
Alcohol Use among European Adolescents: A Multilevel Analysis. Psychiatry Journal,
2013 (2013):250215
Kaushik KS, Kapila K and Praharaj AK (2011). Shooting up: the interface of microbial
infections and drug abuse. Journal of Medical Microbiology, 60(4):408-22.
Kemboi GJ, Onkware K and Ntabo OM (2011). Socio-cultural factors that perpetuate the
spread ofHIV among women and girls in Keiyo District, Kenya. International Journal of
Sociology and Anthropology, 3(5):147-152.
Gootenber P (2010). Andean Cocaine: The Making of a Global Drug. The University of
North Carolina Press, Chapel Hill, 448 pp. ISBN: 978-0807859056.
Kenny JP, Chen SA, Kitamura 0, Athina M and George FK (2009). Conditioned
Withdrawal Drives Heroin Consumption and Decreases Reward Sensitivity. The Journal
of Neuroscience, 26(22): 5894-5900.
Kenna D, Babill S and Muller F (2013). HIV Diversity and Classification, Role in
Transmission: Advances in Infectiou Diseases, 3(2): 146-156.
Keshtkar A, Majdzadeh R, Nedjat S, Gholipour M, Badakhshan A, Qorbani M, Vakili M,
Salari H (2012). Characteristics of high-risk sexual behaviours for human
161
immunodeficiency virus infection among Iranian drug abusers. Journal of Addiction
Medicine, 6(2):153-158.
Khamadi SA, Lihana RW, Osman S, Mwangi J, Muriuki J, Lagat N, Okoth FA and
Songok EM (2009). Genetic diversity of HlV type 1 along the coastal strip of Kenya.
AIDS Research and Human Retroviruses, 25(9):919-923.
Khan M. Berger A, Hemberg J, O'Neill A, Typhanye PD and Kristina Smyrk (2012).
Non-Injection and Injection Drug Use and STlfHIV Risk in the United States: The
Degree to which Sexual Risk Behaviours Versus Sex with an STI-Infected Partner
Account for Infection Transmission among Drug Users. AIDS and Behaviour, 17 (3):
1185-1194.
Khan P, Mukhtar S, Anjum F, Tripathi B, Sriprasad S, Dickinson K and Madaan S.
(2013). Fournier's gangrene associated with intradermal injection of cocaine. Journal of
Sexual Medicine, 10(4): 1184-1186.
Kim SG, Jung JB, Dixit D, Rovner R Jr, Zack JA, Baldwin GC and Vatakis DN (2013).
Cocaine exposure enhances permissiveness of quiescent T cells to HIV infection. Journal
of Leukocyte Biology, 94(4):835-843. .
Kimani-Murage EW, Holding PA, Jean-Christophe F, Ezeh, AC Madise NJ, Kahurani,
EN and. Zulu EM (2011). Food Security and Nutritional Outcomes among Urban Poor
Orphans in Nairobi, Kenya. Journal of Urban Health, 88(2).
Kimber Jo, Copeland L, Hickman M, Macleod J, McKenzie J and Mclendon M (2010).
Survival and cessation in injecting drug users: prospective observational study of
outcomes and effect of opiate substitution treatment British Medical Journal, 341 :c3172
Kimura CA, Higa JI, Levin RM, Simpson G and Vargas Y. (2007). Outbreak of
Necrotizing Fasciitis Due to Clostridium sordellii among Black-Tar Heroin Users. 040rd
Journals Medicine Clinical Infectious Diseases, 38 (9): 87-9l.
Kinai E, Nishijima T, Mizushima D, Watanabe K, Aoki T and Honda H(2014). AIDS
Research and Human Retroviruses, 30(6): 553-559.
King DFL, Siddiqui AA, Buffa V, Fischetti L, Gao Y, Stieh D and McKay PF (2013).
Mucosal Tissue Tropism and Dissemination of illY -1 Subtype B Acute Envelope-
Expressing Chimeric Virus. Journal of Virology, 87(2):890.
Kinyanjui DW and Atwoli L (2013). Substance use among inmates at the Eldoret prison
in Western Kenya. BMC Psychiatry, 13:53.
162
Kiptoo M, Brooks J, Lihana RW, Sandstrom P, Ng'ang'a Z, Kinyua J, Lagat N, Okoth F,
Songok EM (2013). HIV-I drug resistance-associated mutations among HIV-l infected
drug-narve antenatal clinic attendees in mral Kenya. BMC Infectious Diseases, 13 :517.
KNBS, (2010). Kenya National Bureau of Statistics, Population and Housing Census
.2009. Nairobi: Ministry of State for Planning and National Development and Vision
2030. Accessed on 29th April 2014 via
http://statistics.knbs .or.ke/nada/index.php/catalog/S S .
Kiwelu IE, Novitsky V, Margolin L, Baca J and Manongi R (2012) HIV-I Subtypes and
Recombinants in Northern Tanzania: Distribution of Viral Quasispecies. PLoS One 7:
e4760S.
Knut L, Williams BG, Cegielski P and Dye C (2010). A consistent log-linear
relationship between tuberculosis incidence and body mass index. International Journal
ofEpidemiology, 39 (1): 149-15S.
Koethe JR and Heimburger DC (2013). Nutritional aspects of HIV-associated wasting in
sub-Saharan Africa. American Journal of Clinical Nutrition, 91: 1138-1142.
Kokavec A, Lindner AJ, Ryan JE and Crowe SF (2009). Ingesting alcohol prior to food
can alter the activity of the hypothalamic-pituitary-adrenal axis. Pharmacology,
Biochemisy and Behavior, 93(2): 170-6.
Koranda JL, Cone 11, McGehee DS, Roitman MF, Beeler JA and Zhuang X (2014).
Nicotinic receptors regulate the dynamic range of dopamine release in vivo. Journal of
Neurophysiology. 111 (1): 103-111.
Korir, W (2013). An analysis of drug abuse along the coastal regron of Kenya.
International NGG Journal, 8(7): 153-158.
Kousiappa I, Charis A, Hezka J, Yiota L, Othonos K and Demetriades 1(2011). AIDS
Research and Human Retroviruses. 27(11): 1183-1199.
Krawinkel, MB (2012). Interaction of nutrition and infections globally: an overview.
Annals of Nutrition and Metabolism, 61(1):39-45.
Krivine A, Odile L, Firtion G, Finkielsztejn L and Jullien V. (2009). Does HIV-1
Subtype D Have a Higher Risk of Vertical Transmission than Other HIV Subtypes? The
Journal of Infectious Diseases, 199:1S53- 1554.
Krizevskiab R, Nativ D, Einat B, Ilana D, Uzi Rand Lewinsohna E. (2008). Quantitative
stereoisomeric determination of phenylpropylamino alkaloids in khat (Catha edulis
Forsk.) using chiral GC-MS.Israel Journal of Plant Sciences, 56 (3).
163
Kumpfer, LK (2014). Family Based Interventions for the Prevention of Substance Abuse
and Other Impulse Control Disorders in Girls. Addiction; 2014 (2014).
Kwange SO and Budambula N (2010). Effectiveness of anti-tuberculosis treatment
among patients receiving highly active antiretroviral therapy at Vihiga district hospital in
2007. Indian Journal of Medical Microbiology, 28:21-25
Lavezzi MA Coma MF, Alfonsi G and Matturri L (2014). Possible role of the a7
nicotinic receptors in mediating nicotine's effect on developing lung-implications in
unexplained human perinataJ death. BMC Pulmonary Medicine, 14:11
Lee H, Jih-Heng L, Li-Tzy W, Jin-Song W, Cheng-Fang Y and Hsin-Pei T (2012).
Survey of methadone-drug interactions among patients of methadone maintenance
treatment program in Taiwan. Substance Abuse Treatment, Prevention and Policy 20 l Z,
7:11.
Lee SC, Klein-SW, Doyon S and Welsh C (2014). Comparison of toxicity associated
with nonmedical use of benzodiazepines with buprenorphine or methadone. Drug &
AlcoholDependence. 138: 118-123.
Lihana RW, Khamadi SA, Lwembe RM, Kinyua JG, Muriuki JK, Lagat NJ, Okoth' FA,
Makokha EP and Songok EM (2009). HIV-l subtype and viral tropism determination for
evaluating antiretroviral therapy options: an analysisof archived Kenyan blood samples.
BMC Infectious Diseases, 9:215.
Liliana RW, Ssemwanga D, Abimiku A and Ndembi N. (2012). Update on HlV-I
. diversity in Africa: a decade in review. AIDS Review, (2):83-100.
Low N, Chersich MF, Schmidlin K, Egger M and Francis SC (2011) Intravaginal
Practices, Bacterial Vaginosis, and HfV Infection in Women: Individual Participant Data
Meta-analysis. PLoS Medicine, 8(2).
MacArthur JG, Minozzi S, Martin N, Vickerman P, Deren S and Bruneau J. (2012).
Opiate substitution treatment and HIV transmission in people who inject drugs:
systematic review and meta-analysis. British Medical Journal, 2012;345:e5945
MacArthur RD and DuPont HL (2012). Etiology and Pharmacologic Management of .
Noninfectious Diarrhea in HlV-Infected Individuals in the Highly Active Antiretroviral
Therapy Era. Clinical Infectious Diseases, 55(6):860-867.
Madise IN, Ziraba AK, Inungu J, Khamadi SA, Ezeh A, Zulu EM, Kebaso J, Okoth V
and Mwau M (2012). Are slum dwellers at heightened risk of HIV infection than other
urban residents? Evidence from population-based HIV prevalence surveys in Kenya.
Health Place, 18(5):1144-1152.
(
164
Mahmoudi A and Moshayedi M (2012). Life Skills Education for Secondary Education.
Life Science Journal, 9(3).
Majidpour AMD, Majidpour MDS and Quassemi MM (20] 2). Prevalence of hepatitis
B virus (fill V), hepatitis C virus (HCV) and human immune-deficiency virus (ill V)
infections among intravenous drug users (IDUs) in the ¥AH-o-MEHR Harm Reduction
Center of Tehran, Iran Journal of AIDS and HIV Research, 4(6):152-158.
Maleche A and Day E (2011). Traditional cultural practices and HlV: reconciling culture
and human rights. Working Paper for the Third Meeting of the Technical Advisory Group
of the Global Commission on HlV and the Law, 7-9 July 2011. 2011. Accessed on 10
May 2014 via http://kelinkenya.org/wp-content/uploads/20 1011O/traditional-cultural-
practiceshiv-reconciling-culture-andhuman-rights.pdf.
Mamani M, Mohammad MM, Saadat T, Ronak M and Ka-myab A (2013). Latent and
Active Tuberculosis: Evaluation of Injecting Drug Users. Iranian Red Crescent Medical
Journal, 15(9).
Manoranjan S. D'Souza and Markou A (2011). Neuronal Mechanisms Underlying
Development of Nicotine Dependence: Implications for Novel Smoking-Cessation
Treatments. Addiction Science & Clinical Practice, 6(1): 4-6.
Maro I, Lahey T, MacKenzie T, Mtei Land Bakari M (2010). Low BM! and falling BM!
predict Hl'V-associated tuberculosis: A prospective study in Tanzania. International
Journal ofTuberculosis and Lung Disease, 14: 1447-1453.
Marshall MM, Kirk GD, Caporaso NE, McCormack MC and Merlo CA (201la).
Tobacco use and nicotine dependence among Hl V-infected and uninfected injection drug
users. Addictive Behaviours, 36:61-67.
Marshall BDL, Milloy MJ, Wood E, Montaner JSG and Kerr T (2011b). Reduction in
overdose mortality after the opening of North America's first medically supervised safer
injecting facility: a retrospective population-based study. The Lancet, 377(9775), 1429-
1437.
Masese L, McClelland RS, Gitau R, Wanje G, Shafi J, Kashonga F et al. (20l3). A pilot
study of the feasibility of a vaginal washing cessation intervention among Kenyan female.
sex workers.London. Sexually Transmitted Infections, 89(3):217-222.
Massey SH, Compton MT and Kaslow NJ. (2014), Attachment security and problematic
substance use in low-income, suicidal, African American women. The American Journal
on Addictions, 23: 294-299.
165
Martins VJB, Toledo FTMM; Grillo, LP; Do Canno PFM and Martins PA (2011). Long-
Lasting Effects of Undernutrition. International Journal of Environtal Research and
Public Health, 8: 1817-1846.
Mathers BM, Degenhardt L, Phillips B, Wiessing L and Hickman M, (2008). Global
epidemiology of injecting drug use and HIV among people who inject drugs: a systematic
review. Lancet, 372(9651):1733-1745.
Maxwell JC and Spence RT (2008). An Exploratory Study ofInhalers and Injectors who
Used Black Tar Heroin. Journal of Maintenance in the Addictions, 3(1), 61-82.
Mayer KH, Bush T, Henry K, Overton ET, Hammer J and Richardson J. (2012).
Ongoing sexually transmitted disease acquisition and risk-taking behaviour among
US mv -infected patients in primary care: implications for prevention interventions.·
Sexully Transmitted Diseases, 39: 1-7. .
Mayhew S, Collumbien M, Qureshi A, Platt L, Rafiq Nand FaiseI A (2009). Protecting
the unprotected: mixed-method research on drug use, sex work and rights in Pakistan's
fight against HIV IAIDS. Sexually Transmitted Infections, 85(2):31-36.
Mateu-Gelabert P, Milagros S, MeyIakhs P, Wendel T and Friedman SR (2010).
Strategies to avoid opiate withdrawal: Implications for HCV and HIV risks. International
Journal of Drug Policy, 21(3):179-185.
Mbwambo J, McCurdy AS, Myers B, Lambdin B, Kilonzo GPand Kaduri P (2012). Drug
trafficking, use, and HIV risk: The need for comprehensive interventions, SAHARA-J:
Journal of Social Aspects ofHIV/AIDS, 9(3): 154-159.
McCance-Katz EF, Gruber VA, Beatty G, Lum P, Ma Q and Difrancesco R (2013).
Interaction of Disulfiram with Antiretroviral Medications: Efavirenz Increases While
Atazanavir Decreases Disulfiram Effect on Enzymes of Alcohol Metabolism. American
Journal of Addiction, 23(2):137-144.
McClelland RS, Lavreys L, Hassan WM, Mandaliya x, Ndinya-Achola JO, Baeten JM
and (2008). Vaginal washing and increased risk of HlV-I acquisition among African
women: a 10-year prospective study. Journal of Infectious Diseases, 195: 698-702.
McComsey GA, Tebas P, Shane E, Michael T, Yin E, Turner O. et al. (2010). Bone
Disease in HIV Infection: A Practical Review and Recommendations for HIY Care
Providers. Clinical and Infectious Diseases, 51 (8): 937-946.
McCurdy SA, Ross MW, Kilonzo GP, Leshabari MT and Williams ML (2006).
HlV/AIDS and injection drug use in the neighborhoods of Dar es Salaam, Tanzania.
Drug and alcohol dependence, 82 (1),23-27.
166
McCurdy SA, Ross MW, Williams ML, Kilonzo GP, Leshabari MT (2010). Flashblood:
blood sharing among female injecting drug users in Tanzania. Addiction, 105(6):1062-70.
McDennid 1M, Hennig BJ, van der Sande M, Hill AV, Whittle HC and Jaye A. (2013).
Host iron redistribution as a risk factor for incident tuberculosis in HIV infection: an 11-
year retrospective cohort study. RMe Infectious Disease, 13:48.
Mcllwraith F, Betts KS, Jenkinson R, Hickey S, Burns Land Alati R (2013). Is Low BM!
Associated With Specific Drug Use Among Injecting Drug Users? Substance Use and
Misuse, 49 (4): 374-382.
Medhi KG, Jagadish M, Ramesh SP, Rajatashuvra A and Senjam GS(2012). Factors
associated with ever HIV testing among injecting drug users (IDUs) in two HIV high
prevalent States ofIndia. Indian Journal of Medical Research, 136: 64-71
Medline Medical Encyclopedia, 2014. Accessed on 1st April 2014 via.
http://www.nlm.nih.gov/medlineplus/ency/article/001522.htm.
Mendoza Y, Bello G, Castillo Mewa J, Marnnez AA and GonzaIez C(2014). Molecular
Epidemiology of HIV-l in Panama: Origin of Non-B Subtypes in Samples Collected
from 2007 to 2013. PLoS ONE 9(1): e85153.
Merritt T, Mazela J and Merritt A (2013). Tobacco smoking and its consequences on
reproductive health: the impact of a lifestyle choices including cigarette smoke exposure
on fertility and birth defects. Przeglad Lekarski, 70(10):779-783.
Methoide, (2013). Heroin overview: Origin and History. Accessed on I" April 20]4 via
http://methoide.fcm.arizona.edu/infocenterlindex.cfm%3Fstid%3 D174
Methoide, (2014). Methamphetamine and Other Illicit Drug Education. Accessed on l st
April 2014 via http://methoide.fcm.arizona.edu/
Miller CL, Fielden SJ, Tyndall MW, Zhang R, Gibson K and Shannon K (20] I).
Individual and structural vulnerability among female youth who exchange sex for
survival. Journal of Adolescent Health, 49(1 ):36-41.
Mimiaga MJ, Reisner SL, Grasso C, Crane HM, Safren SA and Kitahata MM (2013).
Substance Use Among HIV-Infected Patients Engaged in Primary Care in the United
States: Findings From the Centers for AIDS Research Network of Integrated Clinical
Systems Cohort. American Journal of Public Health, 103(8): 1457-1467.
Mineur YS, Abizaid A, Rao Y, Salas R, DiLeone RJ, Gimdisch D and Diano S(2011).
Nicotine decreases food intake through activation of POMC neurons. Science,
10J32(6035):1330-1332.
167
Mizuno Y, David WP, Metsch LR, Gomez CA, Knowlton AR and Latka ME (20] l ). Is
Injection Serosorting Occurring among HIV-Positive Injection Drug Users? Comparison
by Injection Partner's HIV Status. Urban Health, 88(6): 1031-1043.
Moezzi M, Imani R, Khosravi N, Pourheidar B, Ganji F, Karimi A (2014). Hepatitis B
seroprevalence and risk factors in adult population of chaharmahal and bakhtiari province
in 2013. Hepatitis Monthly, 3;14(5):e17398.
MOH, (2011). Bomu Medical Hospital (Changamwe). http://www.ehealth.or.ke/
facilitieslfacility.aspx?fas= 11258.
MOR, (2012). Division of Leprosy Tuberculosis and Lung Disease, Annual Report.
Accessed on 2nd July 2014 via http://www.nltp.co.ke/docs IDLTLD Annual
report 2012.pdf.
MOR, (2013). TB quarterly bulletin Q4, Issue I,Volume IlDecember 2013. Accessed on
2nd July 2014 via http://www.nltp.co.ke/docs/04 NTLD-U bulletin.pdf.
Molina PE, Happel Kl, Zhang P, Kolls JK and Nelson S (2010). Focus On: Alcohol and
The Immune System. Alcohol and Health, 33(1).
Moon HS, Nifong 1M, Nicholson JS, Heineman A, Lion K and Hoeven R. (2014).
Microsatellite-based Analysis of Tobacco (Nicotiana tabacum L.) Genetic Resources'.
Accessed on 8th March 2014 via bttp://handle.nal.usda.govIl0113/37345.
MOPHS, (2010). Ministry of Public Health Sanitation. National Monitoring and
Evaluation Plan. DLTLD/ October, 2010. Accessed on 8th March 2014 VIa
http://www.nltp.co.ke/docsIDLTLD M E plan for SP 2011-2015.pdf.
Moraros J, Falconer J, Rogers M and Lemstra M (2012). Risk Factors Associated with
Higher Injection Drug Use and HlV Rates: Findings from Saskatchewan, Canada. Journal
of AIDS and Clinical Research, S1:009.
Morris CN and Ferguson AG (2006). Estimation of the sexual transmission of HIV in
Kenya and Uganda on the trans-Africa highway: the continuing role for prevention in
high risk groups. Sexually transmitted infections, 82:368-371.
~enda 0 and Mugenda A (2003). Research Methods: Qualitative and Quantitative.
Approaches, Acts Press, Nairobi-Kenya.
Munro A and Allan J (2011). Can family-focussed interventions improve problematic
substance use in Aboriginal communities? A role for social work. Australian Social Work
64(2): 169-182.
168
Munyuwiny S, Kamweya A, Nyandieka L, Murimi N and Ong'ayo OM (2013). Factors
Associated with HIV Risk Sexual Behaviour among Female Domestic Workers in
Nairobi, Kenya. African Journal of Health Science, 25:104-119
Muriuki, JM (2012). HIV-1 subtypes and coreceptor usage in a population from Northem
Kenya (Master's Thesis at Kenyatta University, Kenya). Accessed on 19th April20J4 via
http://ir-library.ku.ac.ke/bitstream/handlel1234 56789/415 9/J ohn%25 2OMartin.PdfOlo3
Fsequence %3.
Murray MR, Morrison PD, Henquet C and Di Forti M (2008). Cannabis, the mind and
society: The harsh realities. Nature Reviews Neuroscience, 8(11):885-95.
Mntnre BN, Keraka NM, Kimuu PK, Kabiru EW, Ombeka VO and Oguya F (2011).
Factors associated with default from treatment among tuberculosis patients in nairobi
province, Kenya: A case control study. BMC Public Health, 11:696.
Myers B, Kline TL, Browne FA, Camey T, Parry C and Jolmson K (2013). Ethnic
Differences in Alcohol and Drug Use and Related Sexual Risks for nrv among
Vulnerable Women in Cape Town, South Africa: Implications for Interventions. BMC
Public Health, 13:174.
NACADA, (2010). The Role of Parents in Prevention and Control of Alcohol and Drug
Accessed on 12th April 2014 via http://www.nacada.go.ke/documents-and-
resources/category/8-research-survey-findings%3Fdownloads.
NACADA, (2012). Rapid Situation Assessment Of The Status Of Drug And Substance
Abuse In Kenya, 2012. Accessed on 12th April 2014 via http://www.nacada.go.ke/
documents-and-resources/category/8-research-survey- findings %3Fdownloads.
NACADA, (2013). Abused Substances. Accessed on 15th April 2014 via
http://www.nacada.go.ke/khat.
NACADA, (2014). Socio-economic and perceived health effects of khat chewing among
persons aged 10-65 years in selected counties in Kenya. Policy Brief No. NAC/13/2014.
Accessed on 15\h April 2014 via http://www.nacada.go.ke/documents-and-
resources/category/8-research-survey- findings%3 Fdownloads.
\
NACC and NASCOP (2012). Kenya AIDS Epidemic Update 2011. Accessed on 6thApril
20] 4 via http://www.nascop.or.kellibrary/3d1FINAL %20Kenya%20Update%2020 12,
%2030%20May.pdf.
Nadjme J and Nouzar N (2014). Etiology of Drug Abuse: A Narrative Analysis. Journal
of Addiction, 2014 (2014).
169
Narconon, (2014). Marijuana information. Accessed on 19th April 2014 VIa
http://www.narconon.org/drug-infonnationlmarijuana-pot.html.
NASCOP, (2008). National AIDS and SID Control Programme, Ministry of Health,
Kenya. July 2008. Kenya AIDS Indicator Survey 2007: Preliminary Report. Nairobi,
Kenya. Accessed on 30th March 2014 via http://nascop.or.ke/library/3dlPreliminary
%2520 Report%2520for%2520Kenya%2520AIDS%2520indica.
NASCOP, (2010). National AIDS and STI Control Programme, Ministry of Public
Health and Sanitation, Kenya. Guidelines for HIV Testing and Counselling and Kenya.
Accessed on 30th March 2014 via http://nascop.or.ke/libraryIHTC /National %20
Guidelines%20 for%20HTC%20in%20Kenya%2020 10.pdf.
NASCOP, (2012a). Rapid Situational Assessment of HfV Prevalence and Related Risky
Behaviours among Injecting Drug Users in Nairobi and Coast Provinces of Kenya.
Accessed on r" April 2014 via http://nascop.or.ke/librarylMarps /MARPs%2520BOOK
%2520REPOR T%2520 .pdf.
NASCOP) (2012b). Guidelines for antiretroviral therapy in Kenya 2011. National AIDS
and STI Control Programme, Ministry of Health, Kenya. Accessed on 101b April 2014 via
http://nascop.or.ke/library/ART%2520guidelineslFinal%2520guidelines%2520re % 2520
prin~10252011.
NASCOP, (2012c). National Manual for the Management of HIV-related Opportunistic.
Accessed on n'" April 2014 via http://nascop.or.ke/library/ART%2520guidelines
/National %2520Manual %2520for%2520the%2520.
NASCOP, (2013). National AIDS and STI Control Programme, Ministry of Health,
Kenya. September 2013. Kenya AIDS Indicator Survey 2012: Preliminary Report.
Nairobi, Kenya. Accessed on n" April 2014 via http://nascop.or.kellibrary/3d /
Preiiminary%20Report%2 Ofor%20Kenya%20AIDS%20indicator%20survey%2020 12.p.
Ndetei, DM (2004). Study on the Assessment of the Linkages Between Drug Abuse,
Injecting Drug Abuse and Hiv/Aids in Kenya: A Rapid Situation Assessment (Rsa).
Nairobi, Kenya, UN Office on Drugs and Crime (UNDOC). Accessed on 8th January via
https:/lwww.unodc.org/pdfIWDR_2005/volume_l_chap3.pdf.
Neaigus A, Reilly KH, Jenness SM, Hagan H, Wendel T and Gelpi-Acosta C (2013).
\ Dual HIV Risk: Receptive Syringe Sharing and Unprotected Sex Among HIV-Negative
Injection Drug Users in New York City. AIDS Behavior, 17(7):2501-9.
Neale J, Nettleton S, Pickering L and Fischer J (2012). Eating patterns among heroin
users: a qualitative study with implications for nutritional interventions. Addiction,
107(3):635-41.
170
NeL ED (2010). Diarrhoea and malnutrition. South Africa Journal of Clinical Nutrition,
23(1):15-18.
Needle RH, Burrows D, Friedman SR, Dorabjee J, Touze G and Badrieva L (2005).
Effectiveness of community-based outreach in preventing HfV/AIDS among injecting
drug users. International Journal of Drug Policy, 16(5); 45-47
Needle RH and Zhao L (2010). illV Prevention among Injection Drug Users:
Strengthening U.S. Support for Core Interventions. A Report of the CSIS Global Health
Policy Center. Accessed on 1st April 2014 via http://csis.org/files/ publication! 100408_
Needle _IDVPrevention _web.pdf.
NIAAA, 2013. National Institute on Alcohol Abuse and Alcoholism. Alcohol Facts and
Statistics. Accessed on lst April 2014 via http://www.niaaa.nih.gov/aicohol-
health/overview-alcohol-consumption!a1cohol-facts-and-statistics.
Niazi MR, Ullah K, Khallid Z and Waseem I (2009). Is Poverty to be Blamed for
Narcotic Abuse? A Case Study of Pakistan. International Journal of Basic & Applied
Sciences, 09 (l0).
Niccols A, Milligan K, Sword W, Thabane L, Henderson J and Smith A (2012).
Integrated programs for mothers with substance abuse issues: A systematic review of
studies reporting on parenting outcomes. Harm Reduction Journal, 9: 14.
NIDA, (2012). National Institute on Drug Abuse, The Science of Drug Abuse and
Addiction. Accessed on 1st April 2014 viahttp://www.nlm.nih.gov /medlineplus/ency
/article/OO1522.htm.
Nida, (2013a). mode oh heroin injection Accessed on 2nd April 2014 via http://www.
drugabuse. gov/pub1ications/drugfactslheroin.
Nida, (2013b). effects of heroin Accessed on 2nd April 2014 via http://www. drugabuse.
gov/publications/drugfacts/heroin.
NIDi\, (2013c). DrugFacts: Cocaine. Accessed on 3rd' April 2014 via http://www.
drugabuse. gov/publicatiolls/drugfacts/cocaine.
NIDA, (2014). DrugFacts: Marijuana. Accessed on 1st April 2014 via (http://www.
drugabuse. gov/publications/dru gfacts/marijuana).
Nidimusili AJ, Mennella J and Shaheen K. (2013). Small intestinal ischemia with
pneumatosis in a young adult: what could be the cause? Case Reports in Gastrointestinal
Medicine, 2013(2013).
171
Nigam JS, Bharti IN, Kumar D and Sharma A (2013). A Comparison of Hemoglobin
Levels in Untreated and Treated Groups of ill V Patients on ART Including Zidovudine.
Pathology Research International, 2013(2013).
NlH, (2011). National Institutes of Health, Opiate withdrawal. Accessed on 15th February
2014 via http://www.n1m.nih.gov/medlineplus/ency/article/000949.htm.
NIH, 2012. Opiate withdrawal Accessed on accessed on 26th July 20J3
http://www.nlm.nih.gov/medlineplus/ency/article/000949.htm.
Nayer A (2014). Amyloid A amyloidosis: frequently neglected renal disease in injecting
drug users. Journal ofNephropathology, 3(l):26-28.
Ngugi EN, Roth E, Mastin T, Nderiru MG and Yasmin S (2012). Female sex workers in
Africa: Epidemiology overview, data gaps, ways forward. Journal of Social Aspects of
HIVIAIDS, 9 (3).
Noor SW, Ross MW, Lai 0 and Risser JM (2013). Clustered drug and sexual Hl V risk
among a sample of middle-aged injection drug users, Houston, Texas. AIDS Care.
25(7):895-903.
Noroozi M, Nedjat S, Golestan Band Majdzadeh R (2012). What are differences between
non-injecting and injecting drug addicts? International Journal of Preventive Medicine.
3:414~·>419.
Nordqvist, C (2013). What is nicotine? Accessed on 2nd July 2014 http://www. medical
newstoday.comlarticles/240820.php. "
Novak SP and Kral AH (2011). Comparing injection and non-injection routes of
administration for heroin, methamphetamine, and cocaine users in the United States.
Journal of Addiction Disorders, 30:248-257.
Nsimba SE, Kayombo EJ, Massele AY, Laurent Y and Lusajo M (2013). Characteristics
of drug abusers inan urban community of Tanzania. American Journal of Research
Communication, 1(7)
NUUA, (20] 4). Brown heroin, white smack with a tan or the real deal? Accessed all l "
"" April 2014 via http://www.nuaa.org.aulindex.php?option=colTI_content &view=articlc
"&id=] 04&Itemid.
Nyamache AK, Muigai AW and Khamadi SA (2013). Circulating trends of non-B HIV
type 1 subtypes among Kenyan i.ndividuals. AIDS Research and Human Retroviruses,
29(2):400-3.
.kENYAlTA ~NIVEIJS'T'I UB
172
Odek-Ogunde M, Lore Wand Owiti FR (2003). Risky behaviours among injecting drug
users in Kenya. Paper presented at 1.4111International Conference on the Reduction or
Drug Related Harm, April 2003, Chiang Mai, Thailand.
Odendal, L (2011). Indonesia: Injecting drug use a major risk factor for HIY-associatcd
TB. http://www.aidsmap.comJIndonesia-Injecting-drug-use-a-major-risk-factor-for-Hl y-
associated- TB/page/2122520/
Odenwald M, Lingenfelder B, Wolfgang P, Farhan AH and Abdirisak MW(20 1J). A
pilot study on community-based outpatient treatment for patients with chronic psychotic
disorders in Somalia: Change in symptoms, functioning and co-morbid khat use
International Journal of Men tal Health Systems, 6:8.
Odinokova V, Rusakova M, Urada LA, Silverman JG and Raj A (20\4). Police sexual
coercion and its association with risky sex work and substance use behaviours among
female sex workers in St Petersburg and Orenburg, Russia. International Journal of Drug
Policy, 25: 96-104.
Ogbu CU, Lotfipour Sand Chakravarthy B (2014). Addressing the Spectrum of
Polysubstance Abuse: Alcohol, Opioids and Benzodiazepines Require Coordinated
Engagement by Society, Patients, and Physicians. Western Journal of Emergency
Medicine, 16(1):17-19.
O'Gurek TD and Kirchner TJ (2010). Needle Exchange for HIV/AIDS:An Effective
Public Health Policy. Journal of Lancaster General Hospital. Summer 2010 - Vo!.5,
NO.2. Accessed on 29th April 2014 via http://\-v.:ww.jlgh.org!Past-lsslies/Volllllle-5-:::
Issue-2INeedle-Exchange-for-HIV-AIDS--An-Effective-Public-.aspx.
Oino GP, Towett G and Ngunzo FK (2014). Patterns and Dynamics of Psychoactive
Substance 'Use among Street Children in Eldoret Municipality, Kenya. International
Journal of innovation and Scientific Research, 7(2): 163-170.
Oino P and Sorre B (2013). The Danger of IllV/AIDS Prevalence among Street Children
on the Public in Kenya: Experiences from Eldoret Municipality. International Journal o]
Science and Research, 2 (3).
Oliveira I, Andersen A and Furtado A (2012). Assessment of simple risk markers for
early mortality among Hl V-infected patients in Guinea-Bissau: a cohort study. British
MedicalJournal, Open, 2(e001587).
Olsen :MF, Alemseged A, Kzestel P, Tesfaye M, Yilma D and Girma T(20] 4). Effects of
nutritional supplementation for HIV patients starting antiretroviral treatrnent: randornised
controlled trial in Ethiopia. British Medical Journal, 348 (g3187).
173
Opium, (2014). History of Opium. Accessed on 1st April 20)4 vra
http://www.opium.orglllistory-of-opiurn.htmi .
Ornoy A and Ergaze Z (2010). Alcohol Abuse in Pregnant Women: Effects on the Fetus
and Newborn, Mode of Action and Maternal Treatment. International Journal of
Environmental Research and Public Health, 7:364-379.
Orsetti E, Staffolani S, Gesuita R, De Iaco G, Marchionni E and Brescini L(20Ll).
Changing characteristics and risk factors of patients with and without incident Hev
infection among HI V-infected individuals. Infection, 41 (5):987-990.
Osman S, Lihana RW, Kibaya RM, Ishizaki A, Bi X, Okoth FA, Ichimura H and
Lwembe RM (20 l3). Diversity of HfV type 1 and drug resistance mutations among
injecting drug users in Kenya. AIDS Research and Human Retroviruses, 29( 1): 187-190.
Palm AA, Esbjornsson J, Mansson F, Kvist A, Per-Erik I and Biague A(2013). Faster
progression to AIDS and AIDS-related death among seroincident individuals infected
with recombinant HIV-l A3/CRF02 AG compared to sub subtype A3. Journal of
Infectious Diseases. 209(5):721-728 .
Padmanesan N, Wood J, Macintyre CR and Mathai D (2013). Risk Factors for
Tuberculosis. Pulmonary Medicine, 2013(2013).
Palmateer N, Hutchinson S, McAllister G and Murrro A(2014).D. Risk of transmission
assoc.iated with sharing drug injecting paraphernalia: analysis of recent hepatitis C virus
(HCV) infection using cross-sectional survey data. Journal of Viral Hepatitis, 2 \: 25-32.
Paraskevis D, Nikolopoulos G, Tsiara C, Paraskeva D and Antoniadou A (2011). Hl V-I
outbreak among injecting drug users in Greece, 2£)11: a preliminary report
EuniSurveillance, 16(36).
PatTY C, Petersen P, Carney T, Dewing S and Needle R (2008). Rapid assessment of drug
use and sexual HIV risk patterns among vulnerable drug-using populations in Cape
Town, Durban and Pretoria, South Africa. SAHARA Journal, 5:113-119.
Parry CD, Carney T, Peterson P, Dewing S and Needle R (2009). Hlv-risk
behaviour among injecting or non-injecting drug users in Cape Town, Durban, and
Pretoria, South Africa. Substance use and misuse, 44(6):886-904.
Patterson TL, Volkmann T and Gallardo M (2012). Identifying the HIV transm ission
bridge: which men are having unsafe sex with female sex workers and with their own
wives or steady partners? Journal of Acquired Immune Deficiency Syndrome, 60: 414-
420.
174
Peltzer K, Ramlagan S, Johnson BD and Phaswana-Mafuya N (2010). Illicit drug use and
treatment in South Africa: a review. Substance Use and Misuse, 45: 2221-2243.
Phe T, Thai S, Veng C, Sok S and Lynen L (2013) Risk Factors of Treatment-Limiting
Anaemia after Substitution of Zidovudine for Stavudine in HIV-Infected Adult Patients
on Antiretroviral Treatment. PLoS ONE, 8(3): e60206.
Pickett EK and Wilkinson RG (2010). Inequality: an under acknowledged source of
mental illness and distress. The British Journal o] Psychiatry, 197: 426-428.
Pilhatsch M, Scheuing H, Kraemer N, Kobiella A and Bidlingmaier M (2014). Nicotine
administration in healthy non-smokers reduces appetite but does not alter plasma ghrelin,
Human Psychopharmacology-Clinical and Experimental, 29:384-387.
Plowman, T (2008). The identification of coca (Erythroxylum species): 1860-1910.
Botanical Journal of the Linnean Society. DOl: 10.11l1/j.l 095-8339 .1982.tb00368.x.
http://onlinelibrary.wiley.comldoi/IO.IIllh.l 095-8339 .l982.tb00368.x/abstract
Pubchern, (2014). Accessed on 19th April 2014 via http://pubcheni.ncbi. nlm.nih. goyl
summary/summary.cgi?cid=89594#itabs-2d.
Public Health England, (2013). Tetanus: information for health professionals. Accessed
on 29th April 2014 via http://www.hpa.org.uk Iwebcl HPA webFilel HPAweb
C/1194947374762.
Quach AL, Wanke CA, Schmid CH, Gorbach SL and Mwamburi DM(2008). Drug Use
and Other Risk Factors Related to Lower Body "Mass Index among Hl v-Iufected
Individuals. Drug Alcohol Dependence, 95(1-2): 30-36.
Rafiey H, Narenjiha H, Shirinbayan P, Noori R, Javadipour M, Roshanpajouh M, Samie:
Maud, Assari S (2009). Needle and syringe sharing among Iranian drug injectors. Harm
Reduction Journal, 6:21
Ramezani A, Amirmoezi R, Yolk JE, Aghakhani A and Zarinfar N (2014). Hey, HBV,
and HIV seroprevalence, coinfections, and related behaviours among male injection drug
users in Arak, Iran. AlDS Care, 26(9): 1122-1126.
Ramjee G and Daniels B (2013). Women and HlV m Sub-Saharan Africa. A1DS
Research and Therapy, 10:30.
Ramsin 8, Trescot AM, Datta S, Buenaventura R, Adlaka R and Sehgal N (2008). Opioid
Complications and Side Effects. Pain Physician, 11:S105-S 120.
Rankin, M (2010). Andean Cocaine: The Making of a Global Drug. Journal of' World
Hist01Y, 21(3):566-568.
175
Redmond S, Kenter E, Garside R, Low N, Egger M and Martin HA (2011). Patterns of
vaginal practices across Sub-Saharan Africa and their correlation with HIV - a systematic
review. Social science and medicine, 74(9):1311-1323.
Reif S, Preethy G, Braude L, Dougherty RH, Daniels AS and Ghose SS (2014).
Residential Treatment for Individuals With Substance Use Disorders: Assessing the
Evidence. Psychiatric Services, 65:301-312.
Research to Prevention, (2010). Peer Education Rigorous Evidence -Usable Results.
Accessed on 29th April 2014 via http://www.jhsph.edu/research/centers-and-
institutes/research-to-prevention/publications/peereducation.pdf.
Reyes JC, Perez CM, Colon HM, Dowell MH and Cumsille F (2013). Prevalence and
Patterns of Polydrug Use ill Latin America: Analysis of Population-based Surveys in Six
Countries. Review of European Studies, 50).
Rhodes T, Sarang A, Vickerman P and Hickman M. (2010). Policy resistance to harm
reduction for drug users and potential effect of change. British Medical Journal.
341 :c3439.
Roncero C, Martinez-Luna N, Daigre C, Grau-L6pez Land Gonzalvo B (2013).
Psychotic symptoms of cocaine self-injectors in a harm reduction program. Substance
Abuse, 34(2):118-121.
Ross MW, McCurdy SA, Kilonzo GP, Williams ML and Leshabari MT (2008). Drug use
careers and blood-borne pathogen risk behaviour in male and female Tanzanian heroin
injectors. American Journal of Tropical Medicine and-Hygiene, 79(3): 338-343.
Rosso, MA (2010). Poppy and Opium in Ancient Times: Remedy or Narcotic?
Biomedicine International, 1: 81-87
Rubinstein Marcelo and Low MJ (2011). The Smoking Gun III Nicotine-Induced
Anorex..ia.Cell Metabolism, 14(2): 145-147.
Rnutel 'RK, Parker D, Sobolev I and Helle-Mai L(2012). Tuberculosis Knowledge
among Injecting Drug Users Visiting Syringe Exchange Programme in Tallinn, Estonia.
Central European Journal of Public Health, 20(4): 248-25
Ryland EG, Tang Y, Christie CD and Feeney ME (2010). Sequence Evolution of HIV-J
following Mother-to-Child Transmission. Journal of Virology, 84(23): 12437-12444
Saaka M and Osman SM (2013). Does Household Food Insecurity Affect the Nutritional
Status of Preschool Children Aged 6-36 Months? International Journal of' Population
Research, 2013(2013)
176
Saeland M, Haugen M and Eriksen F (2011). High sugar consumption and poor nutrient
intake among drug addicts in Oslo, Norway. British Journal of Nutrition, 105(4):(j 18-
624.
Sagoe KW, Dwidar M, Adiku TK and Arens MQ (2009). HIV-l CRF 02 AG polymerase
genes in Southern Ghana are mosaics of different 02 AG strains and the protease gene
cannot infer subtypes. Virology Journal 2009, 6:27.
Sahin I and Ersin (2014). The Effectiveness of School-Based Drug Resistance Education
Program in the United States. European Scientific Journal, 10(5):1857-7881.
Sahin, 1. and Matusitz J (2013). Using Network Theory to Improve Outcomes for Drug
Law Enforcement Agencies. Journal ofPolicy Practice, 12(2):125-142.
Salmon AM, Van Beek I, Amin J, Kaldor J and Maher L (2010). The impact or a
supervised injecting facility on ambulance call-outs in Sydney, Australia. Addiction,
]05(4),676-683.
SAMHSA, (2010). Substance Abuse and Mental Health Services Administration, Drug
Abuse Warning Network, 2010: National Estimates of Drug-Related Emergency
Department Visits. Accessed on 29th April 2014 via bttp:llwww.samhsrt.
gov/di!.ta/2k13/DA WN2kl OED IDAWN2kl OED.hlm.
SAMHSA, (2012). Substance Abuse and Mental Health Services Administration, Center
for Behavioural Health Statistics and Quality. Treatment Episode Data Set (TEDS):
2000-2010. National Admissions to Substance Abuse Treatment Services. DASIS Series
S--61, HHS Publication No. (SMA) 12-4701. Rockville, MD: Substance Abuse and
Mental Health Services Administration, 2012.
I
Sanders-Buell E, Bose M, Abdul N, Todd CS and Stanekzai MR (2010). Distinct
Circulating Recombinant Hfv-I Strains Among Injecting Drug Users and Sex Workers
in Afghanistan. AIDS research and human retroviruses, 26(5).
Sarkar R, Reshmi P, Baishali B, Ranajoy M, Satarupa Sand Sarkar K (20 II). Genetic
Characterization of Hl V-I Strains among the Injecting Drug Users in Nagaland, India.
The Open Virology Journal, 5: 96-102
Sesay, W (2010). Female bodies: Gender inequalities, vulnerability, HIV and AIDS in
Kenya. Advancing Women in Leadership Journal, 30(17).
Shannon K, Kerr T and Milloy M (2011). Severe food insecurty is associated with
elevated unprotected sex among HIV-seropositive injection drug users independent of
HAART use. AIDS, 25:2037-2042.
177
Shannon K, Strathdee SA and Goldenberg SM(2014). Global epidemiology of HIV
among female sex workers: influence of structural determinants. Lancet, 385(9962):71-
73
Schmidt A, Borgwardt S, Hana G, Wiesbeck GA and Schmid 0 (2013). Acute Effects or
Heroin on Negative Emotional Processing: Relation of Amygdala Activity and Stress-
Related Responses. Journal 0.( Biological Psychiatry, 76(4):289-296.
Scott, 1. (2012). Hundred-year history of heroin, from cough medicine to underworld
narcotic. Accessed on 2617/2013 via http://www.historytodav.comlian-scott/heroin-
hl1ndred~year-habit.
Semba RD, Darnton-Hill I and de Pee S (2010). Addressing tuberculosis in the context of
malnutrition and HIV coinfection. Food and Nutrition Bulletin, 31(4):S345-364. (
Shalini D, Das Chugh T and Shalini AK. (2012). HIV and Malnutrition: Effects on
Immune System. Clinical and Developmental immunology, 2012(2012).
Sharma P, Pratima M and Bharath MS. (2012). Chemistry, Metabolism, and Toxicology
of Cannabis: Clinical Implications. Iran Journal of Psychiatry, 7(4): 149-156.
Shartnin, S (2011). Drug Use and Harm Reduction Model: Responding to the Health
Challenge ofInjecting Drug Users in Bangladesh. International Journal 0.( Social Science
Studies, 1(2).
Sharp PM and Hahn BH (2010). The evolution of HIV-l and the ongin of AfDS.
Philosophical Transactions of the Royal Society, 365(1552):2487-2494.
Sharp PM and Hahn BH (2011). Origins of HIV and the AIDS Pandemic. Cold Sprmg
Harhor Perspectives inMedicine, 1(1):a006841.
Shen C, Craigo J, Ding M, Chen Y and Gupta P (201 I). Origin and Dynamics or Hl V- i
Subtype C Infection in India. PLoS ONE, 6(10): e25956.
Sigaloff KC, Mandaliya K, Hamers RL, Otieno F, Jao 1M and Lyagoba F (2012). Short
communication: High prevalence of transmitted antiretroviral drug resistance among
newly Hl.V type 1 diagnosed adults in Mombasa, Kenya. AlDS Research and Human
Retroviruses, 28(9):1033-1037.
Simbarashe T, Mhairi, Brennan AT, Sanne I, MacPhail AP and Fox MP. (20 \:l).
Anaemia among HIV-Infected Patients Initiating Antiretroviral Therapy in South Africa:
Improvement in Hemoglobin regardless of Degree of Immunosuppression and the
Initiating ART Regimen," Journal of Tropical Medicine, 2013(2013).
178
Singer M (2014). The Infectious Disease Syndemics of Crack Cocaine. The Journal o]
Equity in Health, 3(1'),32-44.
Sitienei J, Nyambati V and Borus P(20l3). The Epidemiology of Smear Positive
Tuberculosis in Three TBIHIV High Burden Provinces of Kenya (2003 -20n())
Epidemiology Research International, 2013 (2013). ./
Sitienei JK, Kipruto H, BonIS P, Nyambati V, Sitienei JC, Kihara A and Kosge:
RJ(2014). Predictors of Low Body Mass Index Among Patients with Smear Positive
Pulmonary Tuberculosis in Kenya. International Journal of Tropical Disease (~.Heal/h.
4(4): 427-436.
Soliman C, Rahman IA, Shawky S, Bahaa T, Elkarnhawi Sand EI Sattar AA (2010). HIV
prevalence and risk behaviours of male injection drug users in Cairo, Egypt. All),',
2:S33-38.
Solomon SS, Hawcroft CS, Narasimhan P, Subbaraman Rand Srikrishnan AK (2008).
Comorbidities among HlV-infected injection drug users in Chennai, India. Indian
Journal of Medical Research, 127: 447-452.
Srikala Band Kishore KKV (2010). Empowering adolescents with life skills education in
schools - School mental health program: Does it work? Indian Journal oj Psychiatry,
52(4): 344-349.
Smith HS, Smith JM and Seidner P (2012). Opioid-induced nausea and vomiting. Annal,
of Palliative Medicin, 1(2).
Stoecklein VM, Osuka A and Lederer JA (2012). Trauma equals danger=damage control
by the immune system. Journal of Leukocyte Biology, 92(3):539-551.
Strathdee SA, Philbin MM and Semple SJ (2008). Correlates of injection drug use among
female sex workers in two Mexico-US border cities. Drug and Alcohol Dependence,
92:132-140.
Strike C, Rudzinski K, Ptterson J and Millson M (2012). Frequent food insecurity among
injection drug users: correlates and concerns. BMC Public Health, 12: 1058.
Sunguya BF, Krishna CP, Otsuka K, Yasuoka J, Mluncle JB and Urassa DP (20 I I)
Undernutrition among HIV-positive children in Dar es Salaam, Tanzania: antirerroviral
therapy alone is 110tenough. BMC Public Health, 11 :869.
Suohu KjHumtsce C, Saggurti N, Saban-val Sand Mahapatra B (2012). Understanding
the association between injecting and sexual risk behaviours of injecting drug users in
Manipur and Nagaland, India. Harm Reduction Journal. 18;9:40.
179
Surratt H, Kurtz Sl+and Cicero TJ (2011). Alternate Routes of Administration and Risk
for HIV among Prescription Opioid Abusers. Journal of Addictive Diseases. 30(4) 334-
341.
Sutin AR, Evans MK and Zonderman AB (2013). Personality traits and illicit substances
the moderating role of poverty. Drug and Alcohol Dependence, 1;]3] (3):247-251.
Swe AL, Kay K.N and Rashid AK (2010). Risk behaviours among HTV positiveinjecting
drug users in Myanmar.a case control study. Harm Reduction Journal, 7:] 2
Tadesse N, Tadesse AA, Mengesha ZB and Kefyalew AA (2013). High prevalence 01
HIV/AIDS risky sexual behaviours among street youth in Gondar town: a community
based cross sectional study. BA1e Research Notes, 6:234.
Tang MA, Forrester JE, Spiegelman D, Flanigan T, Dobs A, Skinner S and Wanke C
(2010). Heavy injection drug use is associated with lower percent body fat in a ITIu1ti-
ethnic cohort of Hl'V-positive and HIV-negative drug users from three U.S cities.
American Journal of Drug Alcohol Abuse, 36(1): 78-86.
Tang MA, Bhatnagar T, Ramachandran R, Dong K, Skinner S, Kumar MS, Wanke C/\
(201]). Malnutrition in a population of HIV-positive and HIV-negative drug users living
in Chennai, South India. Drug and Alcohol Dependence, l ; I] 8( 1): 73-77.
TB Alliance, 2012. The TB Pandemic. Accessed on 29th April 2014 via
http://w''\vw.tbaUiance.orgl.
Tegang SP, Abdallah S, Emukule G, Luchters S, Kingola N, Barasa M, Mucheke Sand
Mwarogo P (2010). Concurrent sexual and substance-use risk behaviours among female
sex workers in Kenya's Coast Province: Findings from a behavioural monitoring SlIIVC:V
Journal a/Social Aspects ofJ-!JV/AJDS. 7(4).
Thao Ie TL, Lindan CP, Brickley DB and Giang Ie T (2006). Changes in high-risk
bebaviours over time among young drug users in South Vietnam: a three-province sruclv.
A1DS and behaviour, 10:S47-56.
Tbao VP, Thuy L, Torok EM, Yen NTB, Chau TT and Jurriaans S (2012). HIY-I drug
resistance in anrirerroviral-naive individuals with HIV -I-associated tuberculous
meningitis initiating antiretroviral therapy in Vietnam. Antiviral Therapy, 17905-913.
ThompsonJr RG, Wall MM, Greenstein E, Grant BF and Hasin DS (2013). Substance-
Use Disorders and Poverty as Prospective Predictors of First-Time Homelessness in the
United States. American Journal of Public Health, 103(S2):S282-S288.
Hale LDN and Dreyer SE (2013). Contextual Influences of Substance Abuse Problems
among School Children. Mediterranean Journal of Social Sciences, 4(13).
180
Tobin KE, German D, Spikes P, Patterson J and Latkin C (2011). A comparison of the
social and sexual networks of crack-using and non-crack using African American men
who have sex with men. Journal of Urban Health, 88(6):1052-62.
Tomlinson CA (2010). Effects of IV Drug Abuse http://www.livestrong.cC..m/
articlell95207 -effects-of-iv-drug-abusel.
Trenz RC, Scherer M, Duncan If, Harrell PT, Moleko AG and Latimer WW (2013).
Latent class analysis of polysubstauce use, sexual risk behaviours, and infectious disease
among South African drug users. Drug and Alcohol Dependence, 132(3 ):44 j -448.
Treweek BJ, Amanda JR and Kim DJ (2010). Superadditive Effects of Ethanol and
Flunitrazepam: Implications of Using Immunopharmacotherapy as a Thcrapeui ic.
Molecular Pharmaceutics, 7 (6),2056-2068.
Trujilloa KA, Smith ML and Guaderrama MM (201]). Powerful Behavioural lnteractions
between Methamphetamine and Morphine. Pharmacal Biochem Behaviour .Ionmal,
99(3): 451-458. .
Tun W, Sheehy M, Broz D, Okal J, Muraguri N, Raymond HF, Musyoki H, Kim f\A,
Muthui M and Geibel S (20]4). Hl V and STI Prevalence and Injection Behaviour
Among People Who Inject Drugs in Nairobi: Results from a 2011 Bio-behavioural Study
Using Respondent-Driven Sampling. AIDS Behavior, 19( 1):24-35.
Ulibarri DM., Strathdee SA, Ulloa EC, Lozada R, Fraga MA, Rodriguez eM, De I,;)
Torre A, Amaro H, O'Campo P and Patterson It (2011). Injection Drug Use as a
Mediator Between Client-perpetrated Abuse and HIV Status among Female Sex Workers
in IwoMexico- US Border Cities. AiDS Behavior, 15: 179-185.
\JNAIDS, (2011). Methac\one substitution therapy helps prevent new HIV infections in
Belarus. Accessed on 29th April 2014 via http://www.unaids.org/en/ resources
Ipresscentre/feahlrestories/20 Il1march/20 110302ll1ethadonebelarus(
UNAIDS, (20121' Global report: UNAIDS report on the global AIDS epidemic 2012.
Accessed on 6 June 2014 via http://www.unaicis.org/en/media/unaids/eontentassets
/documents/epidemiology/2012/gr20 12/20121120 UNAlDS Global Report 2012 with
_annexes en.pdf
UNAIDS, (2013), Global Report. Accessed on 8th June 20 I~
h!!u.:I/www .lUlaids .org/en/sites/de fau lt/fi les/en/ media/una ids/con ten tassets/docum ent:;Iep I
demiology /20] 3/gr20] 3/unaids _global Jeport _20] 3__en .pdf.
181
UNAIDS, (2014). Fast-Track - Ending the AIDS epidemic by 2030. Accessed on 2nd Ian
2015. http://www.unafds.org/sites/defaultlfiles/media_assetIJC2686_ WAD201 4report
_en.pdf.
UNICEF, (2011). Measuring malnutrition: individual assessment of acute malnutrition
Accessed on 28u1 May 2014 via http://www.unicef.org/nutritioncillster/files /rnod«
measuring_ malnutrition- fact_ sheet.doc.
UNODC and TISS (2011). Counselling in Targeted Intervention for Injecting Drug
Users: A Resource Guide. A publication of United Nations Office on Drugs and Crime,
Regional Office for South Asia AND Tata Institute of Social Sciences, Murnbai.
Accessed on 26th April 2013 via httQ;LLw_y{w~11Jlod~.QIg[gOClJmel1ts/soJ!.tb_iJ5jil(
TrainingmanuaJslA Resource Guide.pdf.
UNODC, (2009). Guide to implementing family skills training programmes for drug.
abuse prevention. Accessed on 3rd Dee 2013 via http://www.unodc.org /documents
/prevention/famil y -guidelines- E.pd f.
UNODC, (2011a). World drug report 2011, United Nations Office on Drugs and Crime.
Vienna. Accessed on 20 March 2014 via http://wvvw .unodc.org/documents/datcHHld-
analysis/WDR20IllWorlcl Drug Report 2011 ebook.pdf.
UNODC, (20 11b). Counselling in targeted intervention for injecting drug users. Accessed
on 5th April 2014 via http://www.unodc.org/docllments/sollJlEL<; ia/
TrainingmanuaLsI A Resource Guide.pdf.
UNODC, (2012). Association of Drug Use Pattern with Vulnerability and Service
Uptake. Accessed on 21s1 April 2014 via h.tm;/Lwyw.unodc.org/documents/ so!ubasial
publications/research.
UNODC, (2013a). World Drug Report 2013 (United Nations publication, Sales No.
E.13 .XI.6). Accessed on 19th April 2014 via http://www .unodc.org/\lI1odc IseclU'<?d/v,:'_dr(
wdr20] 3/World Drug RepOlt 20l3.pdf.
UNODC, (20 13b). Drug use prevention, treatment and care. Accessed on 1 st April 20 1<1
via https:/lwww:mlOdc.org/unodc/en/drug-prevention-and-treatmcntJindcx.html.
UNODC, (20 13c). Partnership for Action on Comprehensive Treatment (PACT) -
Treating Drug Dependence and its Health Consequences / OFID-UNODC Joint
Programme to Prevent HIV and AIDS through Treatnet Phase II, in Sub-Saharan Africa.
Accessed on 1st April 2014 via http://www.unodc.org/eastemafricaien/illicit-
drugs/treatment-and-care.html.
182
UNO DC , (2014a). The Structure of Morphine. on 15th April 2014 V13
https:l/www.unodc.org!\modc/enldata-and-analysislbulletinlbulletin 1950-0 I 01.
UNODC, (20 14b). The smoking of heroin in Hong Kong. Accessed on 1st April 2014
viahttp://www .unodc.org/unodc/e~data-and-analysis/bulletinlbulletin _19 57-0 I
01_1yage003 .html' .
UNODC, (2014c). The Use of the Cannabis Drugs in India. Accessed on I st April 2014
via bttps:/lwww.unodc.orglunodc/en/data-and-analysislbul1etinlbulletin 1958-01-.
UNODC, (2014d). Information about drugs. Accessed on 10th April 2014 via
hltp:l/www.unodc.org/unodc/en/illicit-dr!!R~!defin.itjons/01 3..J}age003 ..bim!
UNODC, (20 14e). The medical and social problems of khat in Djibouti. Accessed on 1Slh
April 2014 via https://www.unodc .org/unodc/en/data-and-analysisl bulletin{
QulJetin J957-01-01 4 page005.html.
USAID, (2013). The Twin Epidemics: HIV and IB Co-infection. Accessed on 6th June
2013 via http://www.usaid.g.ov/work-usaid/careers. .
USAID, (2014). Agriculture and Food Security. Accessed on 2nd April 2014 via
http://www.usaid.gQvlken~a/agricylture-and-fm2.d..:.~~.
USDA, (2012). Global Food Security. Accessed on 2nd April 2014 vi.a hJtpj/~ •.~~\s..J~sd~
gov /documentslResults-Global-Food-Security.pdf.
Uuskula A, McMahon 1M,Raag M, Silm Sand Ruute! K (2010). Emergent properties of
HIV risk among injection drug users in Tallinn, Estonia: synthesis of individual and
neigbbourhood-level factors. Sexually Transmitted infections, 86(3 ):iii79-84.
Van Gaalen RD and Wahl LM (2009). Reconciling conflicting clinical studies of
antioxidant supplementation as H1V therapy: a mathematical approach. RMC Public
Health: 2009,9(1 ):S] 2.
Van we, (2011). The burden of disease: substance abuse In South Africa. A(i-ICOI7
Journal of Psychiatry, 14 (ll): 80
Van Hoof Logan, 2011. Accessed on 2nd July 2014 via httDS:llbioweb.uwlax,ed~
Bl0203/2011/vanlloof loga/classification.htm.
Van Zanten E, Van der Ploeg T, Van Hoof JJ and Van der Lely N (2013). Gender, age,
and educational level attribute to blood alcohol concentration in hospitalized intoxicated
adolescents; a cohort study. Alcoholism, Clinical and Experimental R(~.\I!.O", Ii.
37(7):1] 88-94.
183
Van Zyl-Srnit RN, Binder A, Meldau R, Semple PL, Evans A and Smith P(20 14)
Cigarette smoke impairs cytokine responses and BCG containment ill alveolar
macrophages. Thorax, 69:363-370 .
Venter E, Gericke GJ and Bekker PJ (2012). Nutritional status, quality of life and CD4
ceU count of adults living with HfV/AIDS in the Ga-Rankuwa area (South Africa). ,)'Olllh
Africa Journal of Clinical Nutrition, 22(3): L24-129.
Verma P, Thakur AS, Deshmukh K, Jha AK and Verma S (2010). Routes of Druj;
Administration. International Journal ofPharmaceutical Studies and Research. I (I ):54-
59.
Vilas-Boas V, Silva R, Palrneira A, Sousa E and Ferreira LM (2013). Development or
Novel Rifampicin-Derived P-Glycoprotein Activators/Inducers. Synthesis, In Silico
Analysis and Application in the RBE4 Cell Model, Using Paraquat as Substrate. FLo,\"
ONE. 8(8): e74425.
V1I1ar LM, de Paula VS, de Almeida AJ, Rodrigues do 6 KM and Miguel JC (2014,
Knowledge and prevalence of viral hepatitis among beauticians. Journal of Me.lieu!
Virology, 86(9):1515-1521.
Vogenthaler NS, Kushel MB, Hadley C, Frongillo Jr EA and Riley ED (2013). Food
Insecurity and Risky Sexual Behaviours Among Homeless and Marginally Housed HI V-
Infected Individuals in San Francisco. AIDS Behavior, 17(5): 1688-1693.
Vogenthaler NS, Hadley C, Lewis SJ, Rodriguez AE and Metsch LR (2014) FOdd
insufficiency among Hl V-infected crack-cocaine 'users in Atlanta and Miami. l'uhlic
Health Nutrition, 13(9): 1478-1484.
Volkow DN, Baler RD, Compton WM and Weiss SRB (2014). Adverse Health Effects
of Marijuana. The New England Journal ofMedicine, 5;370(23):22 \ 9-27.
Vorobjov S, Uuskula A, Des JarIais DC, Abel-Ollo K, Tall! A and Ruutcl K.(201.:)
Multiple routes of drug administration and HIV risk among injecting drug users . .I01lrl?U/
of Substance Abuse and Treatment, 42(4): 413-420.
Wabe NT and Mohammed MA (2012).What science says about khat (Catha eduhs
Forsk)? Overview of chemistry, toxicology and pharmacology. Journal of A~\J7C:/"IIIIt.:IiI(!1
and Integrative Medicine, 2 (I), 29'-37.
WaJeed MA, Al Habib KF, Al-Motarreb A, Singh R, and Hersi (2013). Acute Coronarv
Syndrome and Khat Herbal Amphetamine Use. Circulation, 124: 2681-2680.
184
Wang L, Wei X, Wang X, Li J and Li H (2014) Long-Term Effects of Methadone
Maintenance Treatment with Different Psychosocial Intervention Models. T'l,oS o.v l~'
9(2): e87931.
Watson, S (2013). How Crack Cocaine Works. Accessed on lth April 2014 via
http://science.howstuffworks.comlcrackl.htm.
Watson JM, Fayter D, Mdege N, Stirk L, Sowden AJ and Godfrey C (20 D).
Interventions for alcohol and drug problems in outpatient settings: A systematic review.
.Drug and Alcohol Review, 32: 356-367.
Wechsberg WM, Luseno WK., Karg RS, Young S, Rodman N and Myers 8(2008)
Alcohol, cannabis, and methamphetamine use and other ri.sk behaviours among Black
and Coloured South African women: a small randomized trial in the Western Cape.
International Journal of Drug Policy, 19:130-139.
Weiser SD, Frongillo EA and Ragland K(2008). Food insecurity is associated with
incomplete HIV RNA suppression among homeless and marginally housed Hl V-infccted
individuals in San Francisco ..Journal of General Internal Medicine, 24: 14-20.
Werb D, Kerr T, Nosyk B, Strathdee S, Montaneret J and Wood E (2008). The temporal
relationship between drug supply indicators: an audit of international government
surveillance systems. British Medical JOt/mal Open, 3:e003077.
Werb D, Rowell G and Guyatt G 2011). Effect of drug law enforcement on drug market
violence: a systematic review. International Journal of Drug Policy, 22:81.
WHES, 2012. World Hunger Education Service: Hunger and Nutrition. Accessed 011 ih
July 2013 via http://www.worldhullger.org/articies/Learn /hunger and nutrition .1.!J1ll.
WFP, (2013). Hunger Statistics. Accessed on 7th July 2013 via httQ:I/WWVi.\mLQLgl
hllnge /stats.
Whirl-Carrillo M, McDonagh EM, Hebert 1M, Gong Land Sangkuhl K (2012)
Pharmacogenomics Knowledge for Personalized Medicine. Clinical Phamtacologv 0-
Therapeutics. 92(4): 414-417.
White J, Guenter P, Jensen G and Malone A (2012). Consensus Statement of the
Academy of Nutrition and Dietetics/American Society for Parenteral and Enteral
Nutrition: Characteristics Recommended for the Identification and Documentation of
Adult Malnutrition (Undernutrition). Journal of Academy of Nutrition and Dretetics,
112:730-738.
VlHO, (2008a). Laboratory-based evaluation of 19 commercially available rapid
diagnostic tests for tuberculosis. Special Program for Research and Training ill Tropics I
185
Diseases. Diagnostics evaluation senes, 2. World Health Organization, Geneva.
Switzerland. ~
WHO, (2008b). World Health Organization Policy guidance on drug-susceptibility
testing (DST) of second-line antituberculosis drugs. WHO/HTM/TB/2008.392. World
Health Organization, Geneva, Switzerland. http://wbglibdoc.who.intlhgfJ008!WHO
HTM TB 2008.392 en&pgf
WHO, (2009a). Management of common health problems of drug t1SCL- .
. http://www .who.int/hiv/topics/idu/drug , dependence/hiv yrimary _care _guidelines _sca/'O
Wl-fO, (2009b). Guidelines for the psychosocially assisted pharmacological treatment of'
opioid dependence. Accessed on 29th April 2014 vra
http://www .who. iut/substance abuse/pub lications/Opioid dependence guide lines .pcif7
WHO, (2010). Medicines: access to controlled medicines (narcotic and psychotropic
substances). Accessed on 1st April 2014 VI(l
http://apps. who.int/medicilledocs/enldlJs 18062en.
WHO, (201Ia). Alcohol. Accessed on 1st April 2014 VJa http://www.who.int/ topic5!
alcohol. drinking/en.
WHO, (2011b). Waist circumference and waist-hip ratio: report of a WHO expert
consultation, Geneva, 8-11 December 2008. ISBN 978 92 4150]49 I.
WHO, (2011c). Haemoglobin concentrations for the diagnosis of anaemia and
assessment of severity. Vitamin and Mineral Nutrition Information System. Geneva.
World Health Organization, 2011 (WHOINMH/NHD!MNM/l1.1).
WHO, (2012). Drug-resistant tuberculosis. Accessed on 3rd May 2014 via blmJlwww .
.who. int/tb/challenges/mdr/ tdrfaqs/en/.
WHO, (2013a). Injecting drug use. Accessed on 1st April 2014 VIa
http://www .who.int/mediacentre!factsheets/fs336/en/.
WHO, (20l3b). Global tuberculosis report 2013. Accessed on 30111 May 2014 via bltp~!
www.who.intltb/publications/global report/en/.
WHO, (2013c). Hepatitis B. Accessed on 1st April 2014 via http://ww'~j:yh0Jl!l
mediacentre/factsheets/fs204/en/.
WHO, (20l3d); Immunization, Vaccines and Biologicals. !ill.J:2:llww\v.who,,-uili
imJ.nuIJization/topics/hepati tis b/en/index. html.
186
WHO, (2013e). Hepatitis c. Accessed on I" April 2014 VJa ht!:P://V.WVi.who.
int/mecliacentre/factsheets/fs204/en/.
WHO, (2013f). Tetanus. Accessed on l" April 20]4 VJa http://www.'v\'I).2.:!llt
/toillf.s/tetanus/en/.
WHO, (20 13g). Immunization surveillance, assessment and monitoring: Tetanus
http://www.who.intlimmunization monitoring/diseases/tetanus/en!.
WHO, (2013h). Management of substance abuse: UNODCfWHO Global Initiative all
Primary Prevention of Substance Abuse.
~
WHO, (20l3i). Definitions and reporting framework for tuberculosis- 2013 revisrou.
ISBN 978 92 4 150534 5 (NLM classification: WF 360)
http://apps.who.int!irislbitstream/l0665/ 79199/1/9789241505345 _eng.pdf.
WHO, (2014a). Substance abuse. Accessed
http://www.who.int/topics/substance abuse/en!.
on 20/3/2014 via
WHO, (2014b). Lexicon of alcohol and drug terms published by the World
Organization. Accessed on 2nd April
http://www.who.int/substance abuse/terminology/who lexicon/enl.
Heal tit
2014
WHO, (2014c). Food Security. Accessed
http;!/www.who.int/trade/glossary/stoD'028/en!.
WHO, (2014d). Global tuberculosis report. 2014( Accessed on 231d Jan 2015 via
http://www.who.intltb/publications/globalJeportien/.
on 2014 via
WHO, UNODC and UNAIDS (2008). Policy guidelines for collaborative TB and JJ[V
services for injecting and other drug users. ISBN: 978 92 4 ] 59693 O.
WHO, UNODC and UNAlDS (2012). WHO, UNODC, UNAIDS Technical Guide For
Countries To Set Targets For Universal Access To HlV Prevention, Treatment And Care
For Injecting Drug Users. ISBN 97892 4 1504379 ..
Wick, .TY(2013). The history ofbenzodiazepines. Consultant Pharmacist, 28(9)518-4~.
Williams ML, McCurdy SA, Bowen AM, Kilonzo GP, Atkinson JS, Ross MW and
Leshabari MT (2009). my seroprevalence in a sample of Tanzanian intravenous drug
users. AIDS Education and Prevention, 21: 474-483.
Wilkinson R and Pickett K (2010). The Spirit Level: Why Equality IS Better for
Everyone. Journal of Socia! Policy, 42(4):840-842.
187
Wisaksana R, Sumantri R, Indrati AR, Zwitser A, Jusuf H and De Mast Q (2013).
Anaemia and iron homeostasis in a cohort of HIV infected patients in Indonesia. BMC
Infectious Diseases, 11 :213.
Wu Z and Clark N (2013). Scaling up opioid dependence treatment in low- and middle-
income settings. Bulletin of the World Health Organization, 9] :82-82A
Xiea X, Wellsa AM and Fuchsa RA (2014). Cocaine seeking and taking: role of
hippocampal dopamine Dl-like receptors. international Journal of
Neuropsychopharmacology, 17(9): 1533-8.
Yann SM, Abizaid A, Rao Y, Salas R, DiJeone RJ, Gundisch 0 and Diano S (2011)
Nicotine Decreases Food Intake Through Activation of POMC Neurons. Science, :< .12
(6035) 1330-1332.
Yen-lu C, Yu-Huei HC, ShaoY; Diana Yu-Ting K and Yu-Ching L(20]O). Molecular
Epidemiology of HIV-l Subtype B, CRFOI_AE, and CRF07 _BC Infection among
Injection Drug Users in Taiwan . .lAIDS Journal of Acquired Immune Deficiency
Syndromes, 53 (4): 425-439 ..
Yuan J, Inarni G, Mohle-Boetani J and Vugia DJ (20] 1). Recurrent Wound Botulism
Among Injection Drug Users in California. Clinical Infectious Diseases Advance. 52 (7)
862-866.
Zagorevski DV and Loughmiller-Newman JA (2012). The detection of nicotine in a Late
Mayan period flask by gas chromatography and liquid chromatography mass
spectrometry methods. Rapid Communications in Mass Spectrometry, 26 (4): 403-·411.
Zeleke A. Awoke W, Gebeyehu E and Ambaw F (2013). Khat chewing practice and its
perceived health effects among communities of Dera Woreda, Amhara region, Ethiopia
Open Journal of Epidemiology, 3:160-168.
Zhang H, Tully DC, Hoffmann FG, He J and Kankasa C (2010) Restricted Genetic
Diversity ofIDV-l Subtype C Envelope Glycoprotein from Perina tally Infected Zambian
Infants. PLoS ONE, 5(2): e9294.
Zhang L, Zhang D, YuB, Wang Sand Liu Y(2013a) Prevalence of HIV Infection and
Associated Risk Factors among Men Who Have Sex with Men (MSM) in Harbin, P. R.
China. PLoS ONE, 8(3): e58440.
Zhang L, Yuanbo S, Hsieh E, Weibo X, Xie J, Yang Hand Ying C (2013b). BOlle
turnover and bone mineral density in I-IIV-l infected Chinese taking highly active
antiretroviraJ therapy -a prospective observational study. BMC Musculoskeletal
Disorders, 14:224.
188
APPENDICES
Appendix 1: Map of Kenya and Mombasa County
012515 SIQonleIeII
L-L..J
N
Source: Courtesy of Regional Centre for Mapping of Resources for Development
189
Appendix 2: Interview Schedule
This interview is part of'a PHD research paper by Valentine Budantbula (KU). Your partictpatton
is completely voluntary. Response 10 this interview will be taken as your acceptance to parncipatc.
Please be assured that the information you provide will be treated in the strictest corfidentiality.
DATE:
CENTRE
CODE:
DATE OF BIRTH:
GENDER:
P/ADDRESS:
TEL:
DA ){-----------------1vfONTH-----------------------l'1:AR---------------
DA )T-----------------1v10NTI1-----------------------'{EAR----------------r FO
PART A: SOCIO-ECONOMIC STATUS
l. Education: None
2. Marital Status: Bo Protestant
n Traditionist
D Other (Specify _
D Nilo 10,001-15,000 ,015,001-20,000 0 ~20.0(Jf
5. Employment 0 None 0 Formal 0 Self Employment DStudent
6. If employed what is your current occupation?_
7. Sexual orientation: D Heterosexual D Homosexual D Bisexual
8. Have you had penetrative sex in the last one year? 0 '(es D No
9. If yes, how many sexual partners have you had in the last one year:
D 2-5 D >5 D Impossible to tell
Single 0Married
Widowed
o Separated
D Other
Catholic
D Divorced
3. Religion: D
D
D Muslim
Atheist
4. Income/Month (Ksh): D <5000
___ J
D500 \-\0. OO()
D
10. Age offirst sexual encouriter -------------------
11. Have you ever been forced to have sex without using a condom? DYes D No
12. During the last 12 months, how many times have you avoided arrest by providing the police
officer with a sexual favouO None D twice D 3-5 times D > 5 times
13. In the last 12 months have you had sex in exchange for drugs Yes D 0 D
14. If yes, how many times? D Once D twice D 3-5 times D > 5 times
190
15. Have you ever be~n diagnosed with a STI within the last
Yes No
Six months
I year
--
2-3 years----_. r---- -_.- -"'-
>3 years
t6. If yes, which STl were you diagnosed with?
o Syphilis 0 Gonorrhea D Trichomoniasis
DChlamydia D Herpes D Others (specify _
PART B: ANTHROPOMETRIC DATA
Measurement Unit
1 Weight (kg)
2 Standing Height (ern)
3 Wai st Circumference , (ern)
4 Buttocks (Hip) Circumference (ern)
~~
5 Mid- Upper Ann Circumference (cm)
..-
6 Bust (ern)
PART C: KNO'VLEDGE, ATTITUDE AND PRACTICES
17. Which injection drug (s) do you use?
a)
b)
c) _
d _
18. Which non injecting drug do use?
a)
b)
c) _
d) _
19. When did you start injecting? D< 6 months D6-11 months D 1-3 yrs D .; 3 \'1
191
20. How many times do you inject per day?
D ONCE THRICE D >3 TI.MES
D NO
DNO
23. Have you ever practiced Flashblood? DYESD NO
24. Name some of the health related risks associated with needle/syringe sharing or flashblood
D TWICE D
D YES
22. Have you ever heard of Flashblood? DYES
21 .Have you ever shared syringes?
'2 ,'3----------_. , --------------.---- -_._---_ ...__ ..--._ ...
25. Do you know of any drug rehabilitation centre?
26. If yes name some of them
DYES D NO
; 2 ; 3--------------- ------_._-_.
27. Would you like to be referred to a rehabilitation centre for treatment? D Y1-::S D NO
If yes, Rea son --------------:--------------------------------------- --- ---- -- -'--- ------ --- --- ---- ---- ----- ---..-- .
Jf no, Reason------------------------------------------------------------------------------- ------ --- --..----------
PART D: MEDICAL HISTORY
[) SELF REPORTED MEDICAL HISTORY
28. Have you experienced any of the following in the last TWO weeks?
Fever D Vomiting D Diarrhoea D Headache D Coughing 0
29. Have you been 011 any medication in the last TWO weeks? D YES D NU
30. If yes please specify ARVs ~]tjbiotics D Others .__ . ._ .
31. When did you start using ARV;.?D < 6 months D 6-- 11 months D \-3 yrs D >~)T<;
JJ) MEDICAL EXAMINATION
32. Vital signs
Vital sign Reading
Temperature
,......-_. - -~--•...•...•---.~--
Pulse rate
Blood pressure
192
33. TB Screening ~d testing
a) Physical screening 1
Chest examination
~Coughing
--1
b) Sputum Analysis AFB (-VE) AFB (+VE)
-.--.---.-.--- .. - -- ..._-- --- i
On spot sputum
Early morning sputum
-'---1
---)
Early morning sputum I
I
34. Drug Sensitivity Testing
Drug Sensitive Resistant Borderline Comment
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
193
Appendix 3: ERe clearance
a·'f~ .:J ~I \ t '. •-\j"'-'..!'~r-'
KEl'\'YA1TA l'l':IVI:RSI1Y
nl-1IO' RI:VlI:W C•.),\1.\1ITln:
r3X: 1\7"Z4~/1\7":;7"
Email: ~1r.r£..-.;h!l1.nl1~I"'l!!.k\l ..)f. ~,~
~uJ:D:_··~·~:"I~I;IJ)·'.!Lbl.,tl·.k{·
\\·d~ ..itc: ~'.:.\..':~.\:':'~·.I.I.: 1\_:.~:~
I'. l '. I~'x oJ ~S·i-l.
:'\;lirc,h. ~'l~'l\l\
.;: ,....I.: '~'.J I .:
'·"I"lIlilll' Blul,,,,,IJ ••,,,
Schnol ••f I'uhlic Ilc~11 h.
"''''":1111;1 l:nh·cl~.ity
".0. 1.lux ~311~4. r;"irnhi.
DC3r .\1~. Valentine
,\ f'l'I.!, ',\TIl'1\' i':i1,\Htf:f> "" III) 19.11h ,)1' 2(' 12 . 'IllV Il'ullllUlI :11'.'TII ,.". iIIfl·,·ti"" ;"'" '''~, I
intrnvenous t.lru!,!US('I'S in 1\1olUha,,:\. Kenya. \'l'rsioll ~.
TIlt: arrlicJltion lx-forc the commrttcc is witha research (DJ,ic ·,II\'/PuI1l1l"1:"',\ 'I B l-o-iuf"',IIO"
amol1:.!sl intnt\l'rltuu~ clrllJ! 1I~t..'I-Sin ;\lf1mha~u.Kt·l1~a·. Vcrxiou ,I, Pall'd I!)" ,\tl\': :~1."I:!:
"
\'akllti!l~ Blld:utlt'lIl:t
Sl.'h,,-,IC'I f'III'Iil' 1Ie:)"".
K1.'nv;ut:l \ "n ive r-sitv
r.o. 1'<,,, ·1:',:"1.1. :-i:lir01'i.
3. srn;
The connniuce l1a~ (,.'•...1fl~idl'rl..'d tlrc research pr •..'tttK(~1 ill .H,:~\"t'\.bn~\' \\':~Ii lh •.. h:~'!I":I\:,1 I'!':',,,:,
Re5c';ll'chri.."lh:y 1.st"~th:'ll7,'!..,1,::;) :l1ld lhl.'"Kell~·:tlla l1niv(.'I''\iry I'Ii1h','" J\t'\'!l:\\' l"'!!I!1!il:"l' \,UI~::,ll!h'''', i '"
is (""1the view th.11 ;l.',.:,:linsl thl' tt..."lll.,,,,jl1;'<:clcmcnt s ot I'L'ViL-W,
ANn :\rrROVJ:r\ th"t the research may proceed for" period of ,..•Nf. yl':Ir [r o tn (.,10 ,f1l11l'.:~l' 1:'.
194
i. r'n'~rl'ss rt1r'011S are submitted to the Kl'~r~t' cvcrv .:;i:--' l~k\Jt!:,~ :I~~~~'\ 1.:1' [.. \',": r .
:,\.IlJlIlitt~d:l1 th~ end of litc'llIdy.
ii. Serious :Itld unexpected adverse events rcl.ucd t~~ tilt.' C~"JldIKI('I Ih\.~':llhi\ .I~, :'\ I",':
10 liti< lxxrrd iI11111,'di:lk\l' they occur.
iii. Ck~lr:lIh.'~ mus: h' \....I ttined ior t'~':ln"T'('n:ltic'!l('\f :t!iy L'il"lc':.:ic'l: !::~l:Lri.d \'I;!
((\IH1try i.c, KCH~\1.
When replying, kindly quote the application number at",,",.:.
If you acccpt the decision reached and advice :lIId conditions ;.:i\'cl1 plea:;e ,i:.:" in the '~Kl' pr,", ,ell'.!
below and return 10 KU·ERe a copy of the letter.
EEQ.L1:'IJPl..m;I~.K. <;:;JKONYO
Ct-IAtRMAN J:11{1CS RJ:Vll:W COMMI1TEE
b.. 1,
I .\h.\.·:~:,:·.·:~'.~ :~·.'.'::! :· :1 :ICCC.,t the .i.Ivic« :,i"el1 ;111.1\\'111 rult rll th«
conditions therein.
Signaturc.. :if~~·f~:~~~~7:".;-,. ....(~:.I( .. ~l' I .'.
cc. \'ir<:·Ch:IIIC('IIN
Director: 11I.'litulc Il)1 I\cs-:it rcl I S,:it,lttt' a!ld Tl'lltlll'il':,I'
KENYATTll ' •.un'•....u...
195
Appendix 4: Ministry~of Health, Mombasa County Clearance
RI."Ii,.\"., .' •• ~ ~f'-!..:...:..
l\-lINISTRY OF PUBLIC HEALTH & SANITATIO;-.i
Telegrams: "PROVMED".
MOJ\IBASA
Tel: .Ylomhasa: 2226006/2212867
"Fax:2226006
F.mail: pdph~coa5t!li;yahoo.com
When replying please quote
OvrTCEOF
TIIF. PROVINCIAl. OIRF(,TOI·:
Of PUBLIC II[ALTII ....,
S,\:\IT.·\TIO'i SEltVICE~ f('().\~T
I'ROVI:'JCE
P. O. BOX 90133-8111110
MO"R·\S.·\
Ref: A))l\1.3/S/37/121
D:Jtl': li"I.JULY 2012
District Medical Officers of Health
:.. MombaS<!
~ KlIindlni
RE: REQUEST TO CARRY OUT DATA COLLECTION ON HIV/PULMONARY
TB CO-INFECTION AMONGST INTRAVENOUS DRUG USERS IN
MOMBASA
The bearer of this letter, Valentine Budambula is a PhD student at the
Department of Community Health, Kenyatta University (KU), Nairobi and also a
lecturer at Department of Environment and Health, Mombasa Polytechnic
University College. .
She wishes to carry out data collection in health Institutions and rehabilitations
centres within Mombasa County for a period of one (1) year with effect from 6,r.
July 2012.
Kindly accord her the necessary support.
\ . :-.,.'
Dr. Anisa Omar, OGW
1'1, B, Ch. B M. Med (paed) H. Dip.HSM (Israel)
Provincial Director of Public Health and Sanitation,
COAST PROVINCE
196
Appendix 5: Consent Form- English Version
Study Title: Hl'V/Pulmenary IB Co-Infection amongst Injection Drug Users in Mombasa, Kenya.
Dear participant,
You are invited to take part in this research study because you have a history of injection drug use.
This form tells you why this research study is being done, please read then can decide if you want to
join this study or not. The Principal Investigator in this study is a PhD student at Kenyaua
University. A study team will be working closely with principal investigator and the study will run
for 2 years.
The pUlpose of this study is to determine the factors associated with HIV and pulmonary Tf3 co-
infections among injection drug users. If you choose to participate in this study, the team wi II
require 3ml of blood (HIV voluntary testing and Complete Blood Count) and three early morning
sputum (for TB testing) from you. No drug or chemical will be introduced into your body You can
decide whether to take part in this study or not. You are free to say yes or no. If you say no. your
regular medical care will not change. Even if you join this study, you do not have to stay ill it. you
may stop at any time. It is important to note that there is no financial benefit for participating 111thl)
study at the same time there will be no any cost implications to you. Participation in this study is
important as the findings of the study have the potential of being used to lobby for funding for
antiretroviral drugs (ARVs) and primary healthcare for drug users.
The risks in this study include possible discomfort due to questions on health and personal
behaviour/history. In addition, discomfort may be experienced while a blood sample is br-ing
obtained. Every effort will be made to keep your study records confidential but we cannot guarantee
it. No funds have been set aside to pay any costs if you are harmed because of this stud). 11yuu
think that you were harmed because of this study, contact the Principal Investigator.
By signing my name below, iconfirm the following:
1. I have read (or been read to) this entire consent document. All of my questions have been
answered to my satisfaction.
2. The study's purpose, procedures, risks and possible benefits have been explained to me.
3. I agree to let the study team use and share the health information and other infonnuiion
gathered for this study.
4. 1 voluntarily agree to participate in this research study. I agree to follow the study procedures
as directed,
5. I have been told that I can withdraw from the study at any time.
Participant's Name slgn _
Principal Investigator slgn Date .
Datc----
Note: Below are some of the key contacts
J. Principle investigator - Valentine Budambula 07222822-148
2. KU~ERC kucrc.chairman@,ku.ac.ke
197
Appendix 6: Cons~nt Form- Swahili Version
Mada Ya Utafiti : Uambukizo pamoja wa virusi vya HIV na Kifua kikuu kati ya watumiaji \I'J
rnihadarati kwa kujidunga, Mombasa Kenya.
Kwako mhusika, .
Unaalikwa kushiriki kwenye utafiti kwa sababu uko na historia ya utumiziaji wa mihadaraii kwa
kujidunga shindano. Fornu hii inakuelezea kwa sababu gani utafiti huu unafanywa. Tafadhali
soma fomu hii halafu uamue kama utashiriki kwenye utafiti huu. Mtafiti mkuu ni rnwanafunzi
wa shahada ya philosophia(PHD) katika chuo kikuu cha Kenyatta. Timu ya utafiti itafanya kazi
kwa karibu na mtafiti mkuu, na utafiti mwenyewe utachukua muda wa miaka miwili
lnia hasa ya utafiti huu nikutathimini au kuamua sababu zinazohusishwa na uambukizo paJ1WI:l
wa virusi vya HIV na kifua kikuu kati ya waturniaji wa rnihadarati kwa kujidunga. Ukichagua
knshiriki kwenye utafiti huu, hii timu ya watafiti itahitaji kiasi cha mililita 3 za damn kutok a
kwako( kwa ajili ya upirnaji wa hiyari wa virusi vya HIV na hesabu ya kiwango cha damu) na
pia watahitaji makohozi ya asubuhi (kwa ajili ya upimaji wa maambukizi ya kifua kikuu)
Hakuna dawa ama kernikali zozote zitakazoekwa kwa mwili wako. Unaweza kutoa uarnuzi wn
kushiriki kwenye utafiti huu au la, pia uko hum kuserna ndio ama.la. Ukiserna la matibabu yak o
ya kawaida hayataathirika, Si lazima kubaki kama mshiriki unaweza ukakatiza kushiriki wakati
wowote. Ni muhimu kufahamu kwamba hakuna faida za kifedha kwa kushiriki k wenyc utafui
huu. Wakati huohuo hautagaramika kivyovyote kifedha kwa kushiriki. Kushiriki karika utalit:
huu ni muhimu kwa sababu, uvumbuzi ama majibu ya utafiti huu yatasaidia kupiganin ,1lI
kushawishi misaada ya kifedha kwa dawa za kuvunja rnakali ya virusi na pia afya ya mS1l1.1~1
kwa watumiaji wa mihadarati.
Hatari zinazoambatana na kushiriki katika utafiti huu ni kama usumbufu kutokana na mnswali y::
kiafya na ya kibinafsi hasa tabia na historia yako. Kadhalika utahisi usurnbufu hasa Wilk;111
wakutolewa damu. Juhudi zote zitafanywa kwa ajili ya kuhifadhi habari na jumbe zako zote k,,:\
njia ya usiri wa hali ya juu. Lakini hatuezi kuhakikisha hili. Hakuna fedha <1111\>!170
zirnehifadhiwa kwa ajili yakukufidia endapo utadhurika kutokana na urafiti huu. Kamn
unafikiria kwamba ulidhurika kutokana na utafiti huu wasiliana na mtafiti mkuu.
Kwa kuweka sahihi jina langu nathibitisha yafuatayo:-
1. Nimesoma (ama nimesomewa) karatasi hii ya kutoa idhini ya kukubali, 1Ia masvvali
yangu yote yamejibiwa na nimeridhika. .
·2. Nia, mitindo.hatari pamoja na faida zinazoambatana 11a utafiti huu zirneclczwa kw ;Jngll
3. Nakubali na kuruhusu timu ya utafiti kutumia na kugawahabari za kiafya ama ,1I1li!
yoyote ya habari zitakazo kusanywa kutokana na utafiti huu.
4. Nimekubali kwa hiyari kushiriki kwenye utafiti huu.
5.' Nimeelezwa kwamba ninaweza kukoma kushiriki wakati wowote.
Jina la mshiriki Sahihi----------------------- -------
Mtafiti mkuu Sahihi
Tarehe .__
Tarehe.------- ------.------
Zaidi; wasiliana na wafuatao
1. Mtafiti mkuu: Valentine Budambula kwa nambari ya rununu, 07222822448
2. KU-ERC: Kupitia barua pepe kuerc.chairman@kl!~'Jcke
198
Appendix 7: peR protocol
QL\.quick peR Purification Kit Protocol
This protocol is designed to purify single- or double-stranded DNA fragments from PCR and other
enzymatic reactions. For cleanup of other enzvmatic reactions, follow the protocol as described L'f
peR samples or use the :MinElute Reaction Cleanup Kit. Fragments ranging from 1OJ bp to 10 kb
are purified from primers, nucleotides, polymerases, and salts us-ing QfAquick spin columns in a
rnicrocentrifug e.
Impor-tant points before starting
1. Add ethanol (96-100%) to Buffer PE before use (see bortl e label for volume).
11. All centrifugation steps are carried out at 17,900 x g (13,000 rpm) in a conventional rable.op
microcentrifuge at room temperature.
Ill. Add 1:250 volume pH indicator I to Buffer PB (i.e., add 1.20 ul pH indicator J (0.30 mJ
Buffer PB or add 600 pI pH indicator 1 to 150 ml Buffer PB). The yellow CciC'f of Buffer PB
with pH indicator I indicates a pH of=7.5.
IV. Add pH indicator I to entire buffer contents. Do not add pH indicator 1 to buffer aliquots
v If the purified PCR product is to be used in sensitive microarrav applications. it rnav t c
beneficial ,0 use Buffer PB without the addition of pH indicator 1.
Procedure
1. Add 5 volumes of Buffer PB to 1 volume of the PeR sample and mix. I: is no: necessarv to
remove mineral oil or kerosene. For example, add 500 ul of Buffer PB to 100 .LlI PCR
sample (not including oil).
2. If pH indicator I has beein added to Buffer PB, check that the color of the mixture is vellow
If the color of the mixture is orange or \'101et, add 10 p.1of 3 M sodium acetate'. pH ~ ~. R:1d
mix. The color of the mixture will turn to vellow.
3. Place a Ql.Aquick spin column in a provided 2 rnl collection tube.
4. To bind DNA, apply the sample to the QIAquick COIUDlll and centrifuge for 30-60 s.
5. Discard flow-through. Place the QIAqulck column back into the same tube. C0l1("C(il'!1rules
are re-used to reduce plastic waste.
6. To wash, add 0,75 ml Buffer Pf to the QIAquick column and centrifuge lor -'0--0,) s.
7. Discard flow-through and place the QIAquick column back in the same rube. Centrifu] C ~:l<"
column for an additional 1 min.
ThIPORTA_ 'I: Residual ethanol £rom Buffer PE \\;11 not be completelv removed unless -h('
flow-throug h is discarded before this additional centrifugation.
PCR Purification
8. Place QIAquick column in a clean 1.5 nil microcenrrifuge tube
9. To clute D~A, add SOpI. Buffer EB (10 mM Tris'CI, pH 8.5) or water (rH -.0-S.5) to IlL-
center of the Ql.Aquick membrane and centrifuge the column for 1 min. Alternari ve lv, for
increased D~A concentration, add 30 ul, elution buffer to the center of the QlAquick
membrane, let the column stand for 1 nun, and then centrifuge.
[\IPORT A.'H: Ensure that the elution buffer is dispensed directly onto the QlA.quil'k
membrane for complete elution of bound DNA. The average eluate: volume is ~8 ul, from
50llli elution buffer volume, and 18 ~ from 30fll. duti<:n buffer.
199
App di 8 W k Ien IX : or plan
~ept Nov- July Aug-Dec Aug Sept-
---
EVENT Jan July- Ian 14
2010- June 2012 2012 2013- IDee July ~O14 lOee
Aug 2012 June ~0I3 ~O14
2011
Proposal '-,,,.
"
processmg Y' ',1:
Clearance : ,,:",';
--
,
by ERe " "" ", :"
Training of , I
research i. '
"assistants .' ~.
'.' -.-;Jl, ••..• 1-'-----Data
collection :
HlV gene- "" '
I
" ; ,
typing " "
[Data .'- ~ -." . -- . .- --.-
--... j
analysis " '
"
Thesis ".. " ' .
Iwriting - , I
Manuscript
preparation '-
1----
Results "
Presentation I
I
Thesis \i
submission II
i
Thesis
1
i
I
defense I
j
200
A di 9 BUDGET DATA COLLECTION COSTS.ppen IX : ,.' .
,
Item Description Cos t(Ks hs )
1 Photocopy (Consent forrrs 400 copies K shs. 3 1,200.00
2 Photocopy (questionnaire) 400 copies x 5 pages xKshs.3 6,000.00
3 Email/airtirre 8,000.00
4 Determine kits 4 pkts @ 6000 24,000.00
5 Unigold 2 pkts @ 8000 16. 00000
6 surgical gloves 8 pkts @ 600 4, 800.00
7 syringes 450 @ 17 7,650.00
_ ..... .... - ..-- ._... " ' .n ,w .... - ... _e.··.· "."
8 needles 450 @10 4,500.00
9 Slides 200 pieces @ Kshs 30 6,000.00
10 G Iycene envelops 150 @ 12 I, 800.00
11 filter papers (for DBS) 300 @16 ~, 800.00
12 Ziplock bag; Assorted 3,600.00
13 Desiccants Assorted 3,500.00
14 Humidity indicator 1 tin 2, 500.00
15 EIDA tubes 450 @ 20 9,000.00
16 Plain tubes 450 @2 20 9,000.00
17 Cryovials 9 boxes @ 1900 17, ]00.00
18 Pippe1tes 196 pieces @ 60 11, 760.00
19 Field visits 2 fuel tanks! month for 6 month 48, 000.00
20 Field assistants 2 research assistants and 2 lab 80,000.00
21 Field assistants 2 IOU field mobilizers 40,000.00
22 CD4 Testing 361 IDU @ 1000 36],000.00
23 Full haerrogram 36] IDU @ 400 144,400.00
24 Bus fare reimbursement 36] rDU@ 250 90,250.00
201
ITEM
,
Cost Kshs -
1 UltraPure DNAselRNAse-Free Distilled Water (l xu.Slitre) 2,376.00
2 One-Step Reverse transcriptase 34,956.00
3 AmpIiTaq Gold DNA PoLymerase, with Gold Buffer- {Chemically modified enzyme for automated Hot Start PCR.
IncludeslOx PCR Gold Buffer (500mM KCl, 150mM TrislHCl 32,883.00
pH 8.0) and 25mM MgCl 2 solution for 200 x 50pl reactions}
-
4 MicroAmp Optical 96-Well Reaction Plate (1 PKT/IO) 1024100 ---
5
AmpliTaq Gold PCR Master Mix (200 rxs) Each tube of
AmpliTaq Gold PO~ Master Mix is at 2X the recommended
usage concentration, and contains the following: AmpliTaq Gold 50,440.00- DNA Polymerase 250 U (0.05 U/pI-) GeneAmp PCR Gold
Buffer, 30 mM Tris/HCI, pH 8.05, 100 mM KCI dNTP, 400 pM
each MgC!2, 5 mM Stabilizers ._.-
6 BigDye ® Terminator v l ,1 Ready Reaction Cycle Sequencingr-- Kit [200pL Tube ofBigOye® Terminator v.l.I Ready Reaction 44,405.00
Mix,Tube M13 (-21) Primer,Tube pGEM Control DNA, ImL
Tube of 5x Sequencing Buffer]
7 0.2 mL Polypropylene PCR Tubes (2xCase of250) 34,073.00 j
15 mL Polypropylene Centrifuge Tubes (l xcase of 500)
I
8 56.706B
9 DNA MW Marker, 100 bp Ladder (lOObp-1.5kb (lx250!-l1) 40,120:..~)Q_._
10 Powder-less h~nd Gloves (Large) (case of 1000) 7,480.0o__ ._
11 20 ul micropipette tips (500) I3260.0.9_J
12 IQOOul micropipette tips (500) 1,955.00 _
I
13 200 !-llmicropipette tips (1000) 1,955~~ __.
Eppendorff microcentrifuge tubes (l.5mL, assorted colours and
14 ~!erile) (1 bag) 1,955.00 --
]5 ]OXTBE (1 litre) 8,840.00
16 Ethidium bromide (5 g) 11,90000
17 Denatured Ethanol (molecular biology grade, 1 litre) 6,120.00 ---
BUDGET: HIV GENOTYPING EXPENDITURE
202
- --I
.18 Sodium Acetate (molecular biology grade, 500g) 4,250.00
19 Highly deionized (HiDi) Formamide (l00 ml) 4,335.00
20 POP 6 polymer (3m!) 5,525.00
21 Sequencing tray (96 well sequencing plate, 3 sets) 19,720.00 I
22 Bench fee 130,900.00
23 One-step Rtase 50,150.00.---
24 PRIMER SET-1
25 5'·GGAAACCAAAAA TGATAGGGGGAA TTGGAGG-3' 12,750.00
26 5'·TGACTTGCCCAATTTAGTTTTCCCACT AA-3' 9,775.00 --1
27 5'-GTAGGACCTACACCTGTTCAACATAATTGGAAG-]' .j,
I
28 5'-CCCATCCAAAGAAATGGAGGAGGTTCTTTCTGATG-3' 9227_~·~ I...-...__. - ---
I
PRIMER SET-2 ~
I
29 5'-TCCTT AACTTCCCTCAAATCACT -3' !
30 5'-CTGGCACGGTTTCAATAGGACT-3' 9,775.00 I~ I
I
I
31 5'·GGGAATTTTCTTCAGAGCAG-3 ,
-~
I
32 5'-TCTTCTGTCAA TGGCCATTGT -3' _~}_2~~__ II- ~.---.~-.,......... -~-- -- IPRJMER SET-3 -J
33 5'-TCTTAGGAGCAGCAGCAGGAAGCACT ATGGG-3'
I
I
-- -------.-. ---I
I
34 5'-AACGACAAAGGTGAGTATCCCTGCCT AA-3' 9,775.00 I
35 5'-ACAA TTATTGTCTGGT ATAGTGCAACAGCA-3' !
36 5'-TCCTACTA TCATT ATGAA TATTTTTATATA-3' 9,775.00
--I
J
203
PRIMER SET-4
37 5'-GGGTCACCAT AITCTTGGG-3'
38 5'-CA (AlG) AGACAAAAGAAAATTGG-3' 9,775.00
39 5'-GAACAAGAGCTACAGCATGGG-3'
40 5'-CCACTGCATGGCCTGAGGATG-3' 9,775.00
41 Research Assistants (2) @, 20,000 per month 40,000.00
SUB-TOTAL 705,495.00
PLUS DATA COLLECTION COSTS 904,860.00
GRAND TOTAL 1,610,355.00